Morpholino

MO1-ppp2r2d

ID

ZDB-MRPHLNO-191120-5

Name

MO1-ppp2r2d

Previous Names

None

Target

Sequence

5' - ACCAACCCCTGCCATCATCGCCTGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ppp2r2d

No data available

Phenotype

Phenotype resulting from MO1-ppp2r2d

Phenotype	Fish	Figures
fast muscle cell morphology, abnormal	AB + MO1-ppp2r2d	Fig. 3 from Veloso et al., 2019
fast muscle cell actin filament decreased thickness, abnormal	AB + MO1-ppp2r2d	Fig. 4 from Veloso et al., 2019
fast muscle cell actin filament disorganized, abnormal	AB + MO1-ppp2r2d	Fig. 4 , Fig. 7 from Veloso et al., 2019
fast muscle cell myotome morphology, abnormal	AB + MO1-ppp2r2d	Fig. 3 from Veloso et al., 2019
fast muscle cell nucleus decreased amount, abnormal	AB + MO1-ppp2r2d	Fig. 3 , Fig. 7 from Veloso et al., 2019
fast muscle cell nucleus disorganized, abnormal	AB + MO1-ppp2r2d	Fig. 3 from Veloso et al., 2019
trunk curved, abnormal	AB + MO1-ppp2r2d	Fig. 3 , Fig. 7 from Veloso et al., 2019

Phenotype of all Fish created by or utilizing MO1-ppp2r2d

Phenotype	Fish	Conditions	Figures
fast muscle cell nucleus decreased amount, abnormal	AB + MO1-ppp2r2d	standard conditions	Fig. 3 , Fig. 7 from Veloso et al., 2019
trunk curved, abnormal	AB + MO1-ppp2r2d	standard conditions	Fig. 3 , Fig. 7 from Veloso et al., 2019
fast muscle cell nucleus disorganized, abnormal	AB + MO1-ppp2r2d	standard conditions	Fig. 3 from Veloso et al., 2019
fast muscle cell actin filament decreased thickness, abnormal	AB + MO1-ppp2r2d	control	Fig. 4 from Veloso et al., 2019
fast muscle cell myotome morphology, abnormal	AB + MO1-ppp2r2d	standard conditions	Fig. 3 from Veloso et al., 2019
fast muscle cell morphology, abnormal	AB + MO1-ppp2r2d	standard conditions	Fig. 3 from Veloso et al., 2019
fast muscle cell actin filament disorganized, abnormal	AB + MO1-ppp2r2d	control	Fig. 4 , Fig. 7 from Veloso et al., 2019
fast muscle cell nucleus amount, ameliorated	AB + MO1-ppp2r2d + MO1-sorbs2a + MO2-sorbs2a	control	Fig. 7 from Veloso et al., 2019
trunk curved, ameliorated	AB + MO1-ppp2r2d + MO1-sorbs2a + MO2-sorbs2a	control	Fig. 7 from Veloso et al., 2019
fast muscle cell actin filament organization quality, ameliorated	AB + MO1-ppp2r2d + MO1-sorbs2a + MO2-sorbs2a	control	Fig. 7 from Veloso et al., 2019

Citations