Morpholino

MO1-neflb

ID
ZDB-MRPHLNO-191111-2
Name
MO1-neflb
Previous Names
None
Target
Sequence
5' - CATGATGAATGAAGAGAGAAGAGAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-neflb
No data available
Phenotype
Phenotype resulting from MO1-neflb
Phenotype of all Fish created by or utilizing MO1-neflb
Phenotype Fish Conditions Figures
thigmotaxis delayed, abnormal AB + MO1-neflb standard conditions Fig. 5 from Wang et al., 2018
spinal cord neuron decreased amount, abnormal AB + MO1-neflb standard conditions Fig. 6 from Wang et al., 2018
hindbrain neuron decreased amount, abnormal AB + MO1-neflb standard conditions Fig. 6 from Wang et al., 2018
spinal cord apoptotic process increased occurrence, abnormal AB + MO1-neflb standard conditions Fig. 7 from Wang et al., 2018
spinal cord axon truncated, abnormal AB + MO1-neflb standard conditions Fig. 6 from Wang et al., 2018
central nervous system neuron decreased amount, abnormal AB + MO1-neflb standard conditions Fig. 6 from Wang et al., 2018
hindbrain apoptotic process increased occurrence, abnormal AB + MO1-neflb standard conditions Fig. 7 from Wang et al., 2018
eye decreased size, abnormal AB + MO1-neflb standard conditions Fig. 5 from Wang et al., 2018
hindbrain development process quality, abnormal AB + MO1-neflb standard conditions Fig. 6 from Wang et al., 2018
spinal cord axon decreased thickness, abnormal AB + MO1-neflb standard conditions Fig. 6 from Wang et al., 2018
whole organism malformed, abnormal AB + MO1-neflb standard conditions Fig. 5 from Wang et al., 2018
trunk bent, abnormal AB + MO1-neflb standard conditions Fig. 5 from Wang et al., 2018
brain structure, abnormal AB + MO1-neflb standard conditions Fig. 5 from Wang et al., 2018
thigmotaxis delayed, abnormal AB + MO1-neflb + MO4-tp53 standard conditions Fig. 5 from Wang et al., 2018
eye decreased size, abnormal AB + MO1-neflb + MO4-tp53 standard conditions Fig. 5 from Wang et al., 2018
whole organism malformed, abnormal AB + MO1-neflb + MO4-tp53 standard conditions Fig. 5 from Wang et al., 2018
trunk bent, abnormal AB + MO1-neflb + MO4-tp53 standard conditions Fig. 5 from Wang et al., 2018
brain structure, abnormal AB + MO1-neflb + MO4-tp53 standard conditions Fig. 5 from Wang et al., 2018
whole organism malformed, abnormal AB + MO1-nefla + MO1-neflb standard conditions Fig. 5 from Wang et al., 2018
Citations