Morpholino

MO7-cftr

ID
ZDB-MRPHLNO-190805-1
Name
MO7-cftr
Previous Names
None
Target
Sequence
5' - GACACATTTTGGACACTCACACCAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO7-cftr
No data available
Phenotype
Phenotype resulting from MO7-cftr
Phenotype of all Fish created by or utilizing MO7-cftr
Phenotype Fish Conditions Figures
whole organism viability, ameliorated WT + MO7-cftr bacterial treatment by injection: Mycobacteroides abscessus, viral treatment by injection: Viruses Fig. 5. with image from Johansen et al., 2021
whole organism viability, exacerbated WT + MO7-cftr bacterial treatment by injection: Mycobacteroides abscessus Fig. 5. with imageFig. 6. with image from Johansen et al., 2021
caudal fin fin regeneration decreased occurrence, abnormal WT + MO7-cftr chemical treatment by environment: hydrogen peroxide, amputation: caudal fin Figure 4 with image from Bernut et al., 2020
whole organism viability, ameliorated WT + MO7-cftr bacterial treatment by injection: Mycobacteroides abscessus, viral treatment by injection: Viruses Fig. 5. with image from Johansen et al., 2021
caudal fin fin regeneration decreased occurrence, abnormal WT + MO7-cftr amputation: caudal fin Figure 4 with image from Bernut et al., 2020
whole organism viability, ameliorated WT + MO7-cftr bacterial treatment by injection: Mycobacteroides abscessus, chemical treatment by environment: rifabutin Fig. 6. with image from Johansen et al., 2021
caudal fin duox expression amount, ameliorated WT + MO7-cftr amputation: caudal fin Figure 2 with image from Bernut et al., 2020
whole organism viability, ameliorated WT + MO7-cftr bacterial treatment by injection: Mycobacteroides abscessus, viral treatment by injection: Viruses Fig. 5. with imageFig. 6. with image from Johansen et al., 2021
caudal fin fin regeneration decreased occurrence, ameliorated WT + MO7-cftr chemical treatment by environment: dibenziodolium chloride, amputation: caudal fin Figure 4 with image from Bernut et al., 2020
caudal fin hydrogen peroxide increased amount, exacerbated WT + MO7-cftr amputation: caudal fin Figure 2 with image from Bernut et al., 2020
whole organism viability, ameliorated WT + MO7-cftr bacterial treatment by injection: Mycobacteroides abscessus, viral treatment by injection: Viruses, chemical treatment by environment: rifabutin Fig. 6. with image from Johansen et al., 2021
neutrophil-mediated killing of bacterium decreased occurrence, abnormal i114Tg + MO7-cftr bacterial treatment by injection: Mycobacteroides abscessus Fig. S4 from Bernut et al., 2019
neutrophil increased amount, abnormal i114Tg + MO7-cftr control Fig. S3 with image from Bernut et al., 2019
caudal fin neutrophil apoptotic, ameliorated i114Tg + MO7-cftr amputation: caudal fin Figure 3 with image from Bernut et al., 2020
caudal fin neutrophil increased amount, ameliorated i114Tg + MO7-cftr chemical treatment by environment: dibenziodolium chloride, amputation: caudal fin Figure 2 with image from Bernut et al., 2020
caudal fin neutrophil increased amount, abnormal i114Tg + MO7-cftr amputation: caudal fin Figure 1 with imageFigure 2 with imageFigure 5 with image from Bernut et al., 2020
innate immune response disrupted, abnormal i114Tg + MO7-cftr amputation: caudal fin Figure 1 with image from Bernut et al., 2020
neutrophil chemotaxis decreased occurrence, abnormal i114Tg + MO7-cftr bacterial treatment by injection: Mycobacteroides abscessus Fig. 4 from Bernut et al., 2019
caudal fin neutrophil increased amount, abnormal i114Tg + MO7-cftr chemical treatment by injection: N-formyl-L-methionyl-L-leucyl-L-phenylalanine, amputation: caudal fin Figure 1 with image from Bernut et al., 2020
caudal fin neutrophil increased amount, exacerbated i114Tg + MO7-cftr chemical treatment by environment: hydrogen peroxide, amputation: caudal fin Figure 2 with image from Bernut et al., 2020
macrophage cell death increased occurrence, abnormal ump2Tg + MO7-cftr bacterial treatment by injection: Mycobacteroides abscessus Fig. 3 with image from Bernut et al., 2019
caudal fin neutrophil increased amount, exacerbated s1999tTg; sh267Tg + MO7-cftr amputation: caudal fin Figure 3 with image from Bernut et al., 2020
whole organism decreased life span, abnormal slc24a5b1/b1 + MO7-cftr bacterial treatment by injection: Mycobacteroides abscessus Fig. 1 with image from Bernut et al., 2019
defense response to bacterium decreased efficacy, abnormal slc24a5b1/b1 + MO7-cftr bacterial treatment by injection: Mycobacteroides abscessus Fig. 1 with image from Bernut et al., 2019
whole organism cybb expression decreased amount, abnormal slc24a5b1/b1 + MO7-cftr bacterial treatment by injection: Mycobacteroides abscessus Fig. 6 with image from Bernut et al., 2019
whole organism tnfa expression increased amount, abnormal slc24a5b1/b1 + MO7-cftr bacterial treatment by injection: Mycobacteroides abscessus Fig. S7 from Bernut et al., 2019
caudal fin fin regeneration decreased occurrence, abnormal WT + MO1-duox + MO7-cftr amputation: caudal fin Figure 4 with image from Bernut et al., 2020
caudal fin fin regeneration decreased occurrence, ameliorated WT + MO3-csf3r + MO7-cftr amputation: caudal fin Figure 4 with image from Bernut et al., 2020
caudal fin neutrophil increased amount, ameliorated i114Tg + MO1-duox + MO7-cftr amputation: caudal fin Figure 2 with image from Bernut et al., 2020
Citations