Morpholino

MO2-myt1a

ID

ZDB-MRPHLNO-190328-3

Name

MO2-myt1a

Previous Names

None

Target

Sequence

5' - TTTAAGAGGCTCTAACCTCTGATTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO. Authors provided this corrected sequence.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-myt1a

No data available

Phenotype

Phenotype resulting from MO2-myt1a

Phenotype	Fish	Figures
ceratohyal cartilage angle palatoquadrate cartilage, abnormal	WT + MO2-myt1a + MO4-tp53	Fig. 2 from Lopez et al., 2016
ceratohyal cartilage angle ceratohyal cartilage, abnormal	WT + MO2-myt1a	Fig. 2 from Lopez et al., 2016
ceratohyal cartilage distance Meckel's cartilage, abnormal	WT + MO2-myt1a	Fig. 2 from Lopez et al., 2016
ceratohyal cartilage flattened, abnormal	WT + MO2-myt1a + MO4-tp53	Fig. 2 from Lopez et al., 2016
ceratohyal cartilage increased angle to palatoquadrate cartilage, abnormal	WT + MO2-myt1a	Fig. 2 from Lopez et al., 2016
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal	WT + MO2-myt1a	Fig. 2 from Lopez et al., 2016
ceratohyal cartilage increased distance Meckel's cartilage, abnormal	WT + MO2-myt1a	Fig. 2 from Lopez et al., 2016

Phenotype of all Fish created by or utilizing MO2-myt1a

Phenotype	Fish	Conditions	Figures
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal	WT + MO2-myt1a	standard conditions	Fig. 2 from Lopez et al., 2016
ceratohyal cartilage flattened, abnormal	WT + MO2-myt1a	standard conditions	Fig. 2 from Lopez et al., 2016
ceratohyal cartilage angle ceratohyal cartilage, abnormal	WT + MO2-myt1a	standard conditions	Fig. 2 from Lopez et al., 2016
ceratohyal cartilage increased distance Meckel's cartilage, abnormal	WT + MO2-myt1a	standard conditions	Fig. 2 from Lopez et al., 2016
ceratohyal cartilage angle palatoquadrate cartilage, abnormal	WT + MO2-myt1a	standard conditions	Fig. 2 from Lopez et al., 2016
ceratohyal cartilage increased angle to palatoquadrate cartilage, abnormal	WT + MO2-myt1a	standard conditions	Fig. 2 from Lopez et al., 2016
ceratohyal cartilage distance Meckel's cartilage, abnormal	WT + MO2-myt1a	standard conditions	Fig. 2 from Lopez et al., 2016
ceratohyal cartilage flattened, abnormal	WT + MO2-myt1a + MO4-tp53	standard conditions	Fig. 2 from Lopez et al., 2016
ceratohyal cartilage angle ceratohyal cartilage, abnormal	WT + MO2-myt1a + MO4-tp53	standard conditions	Fig. 2 from Lopez et al., 2016
ceratohyal cartilage distance Meckel's cartilage, abnormal	WT + MO2-myt1a + MO4-tp53	standard conditions	Fig. 2 from Lopez et al., 2016
ceratohyal cartilage angle palatoquadrate cartilage, abnormal	WT + MO2-myt1a + MO4-tp53	standard conditions	Fig. 2 from Lopez et al., 2016

Citations