Morpholino

MO1-myt1a

ID
ZDB-MRPHLNO-190328-1
Name
MO1-myt1a
Previous Names
  • MO-myt1a-ATG (1)
Target
Sequence
5' - CACAACTTCATCTTTGCGGTGATTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-myt1a
Expressed Gene Anatomy Figures
sox10 Fig. 2 from Lopez et al., 2016
Phenotype
Phenotype resulting from MO1-myt1a
Phenotype Fish Figures
ceratohyal cartilage angle palatoquadrate cartilage, abnormal WT + MO1-myt1a Fig. 2 from Lopez et al., 2016
ceratohyal cartilage angle ceratohyal cartilage, abnormal WT + MO1-myt1a Fig. 2 from Lopez et al., 2016
ceratohyal cartilage decreased distance Meckel's cartilage, abnormal WT + MO1-myt1a Fig. S2 from Lopez et al., 2016
ceratohyal cartilage distance Meckel's cartilage, abnormal WT + MO1-myt1a Fig. 2 from Lopez et al., 2016
ceratohyal cartilage flattened, abnormal WT + MO1-myt1a + MO4-tp53 Fig. 2 from Lopez et al., 2016
ceratohyal cartilage increased angle to palatoquadrate cartilage, abnormal WT + MO1-myt1a Fig. 2,  Fig. S2 from Lopez et al., 2016
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO1-myt1a Fig. 2,  Fig. S2 from Lopez et al., 2016
ceratohyal cartilage increased distance Meckel's cartilage, abnormal WT + MO1-myt1a Fig. 2 from Lopez et al., 2016
head decreased length, abnormal WT + MO1-myt1a Fig. 2,  Fig. S2 from Lopez et al., 2016
whole organism sox10 expression increased amount, abnormal WT + MO1-myt1a Fig. 2 from Lopez et al., 2016
Phenotype of all Fish created by or utilizing MO1-myt1a
Phenotype Fish Conditions Figures
ceratohyal cartilage increased angle to palatoquadrate cartilage, abnormal WT + MO1-myt1a standard conditions Fig. 2,  Fig. S2 from Lopez et al., 2016
ceratohyal cartilage distance Meckel's cartilage, abnormal WT + MO1-myt1a standard conditions Fig. 2 from Lopez et al., 2016
ceratohyal cartilage angle palatoquadrate cartilage, abnormal WT + MO1-myt1a standard conditions Fig. 2 from Lopez et al., 2016
whole organism sox10 expression increased amount, abnormal WT + MO1-myt1a standard conditions Fig. 2 from Lopez et al., 2016
ceratohyal cartilage angle ceratohyal cartilage, abnormal WT + MO1-myt1a standard conditions Fig. 2 from Lopez et al., 2016
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO1-myt1a standard conditions Fig. 2,  Fig. S2 from Lopez et al., 2016
ceratohyal cartilage flattened, abnormal WT + MO1-myt1a standard conditions Fig. 2 from Lopez et al., 2016
ceratohyal cartilage decreased distance Meckel's cartilage, abnormal WT + MO1-myt1a standard conditions Fig. S2 from Lopez et al., 2016
ceratohyal cartilage increased distance Meckel's cartilage, abnormal WT + MO1-myt1a standard conditions Fig. 2 from Lopez et al., 2016
head decreased length, abnormal WT + MO1-myt1a standard conditions Fig. 2,  Fig. S2 from Lopez et al., 2016
ceratohyal cartilage increased angle to palatoquadrate cartilage, abnormal WT + MO1-myt1a + MO4-tp53 standard conditions Fig. S2 from Lopez et al., 2016
ceratohyal cartilage distance Meckel's cartilage, abnormal WT + MO1-myt1a + MO4-tp53 standard conditions Fig. 2 from Lopez et al., 2016
ceratohyal cartilage angle palatoquadrate cartilage, abnormal WT + MO1-myt1a + MO4-tp53 standard conditions Fig. 2 from Lopez et al., 2016
ceratohyal cartilage flattened, abnormal WT + MO1-myt1a + MO4-tp53 standard conditions Fig. 2 from Lopez et al., 2016
ceratohyal cartilage angle ceratohyal cartilage, abnormal WT + MO1-myt1a + MO4-tp53 standard conditions Fig. 2 from Lopez et al., 2016
ceratohyal cartilage decreased distance Meckel's cartilage, abnormal WT + MO1-myt1a + MO4-tp53 standard conditions Fig. S2 from Lopez et al., 2016
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO1-myt1a + MO4-tp53 standard conditions Fig. S2 from Lopez et al., 2016
head decreased length, abnormal WT + MO1-myt1a + MO4-tp53 standard conditions Fig. S2 from Lopez et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.