Morpholino

MO3-drl,drll.1,drll.2

ID

ZDB-MRPHLNO-190314-1

Previous Names

Targets

Sequence

5' - TCAAGAACAGACACCAACCTCTTTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-drl,drll.1,drll.2

Expressed Gene	Anatomy	Figures
drl	whole organism	Fig. 2 from Pimtong et al., 2014
drll.1	whole organism	Fig. 2 from Pimtong et al., 2014
drll.2	whole organism	Fig. 2 from Pimtong et al., 2014
fli1	dorsal aorta	Fig. 3 from Kobayashi et al., 2019
gata1a	nucleate erythrocyte	Fig. 3 from Kobayashi et al., 2019
npas4l	posterior lateral plate mesoderm	Fig. 3 from Kobayashi et al., 2019
runx1	dorsal aorta hematopoietic stem cell	Fig. 3 from Kobayashi et al., 2019

Phenotype

Phenotype resulting from MO3-drl,drll.1,drll.2

No data available

Phenotype of all Fish created by or utilizing MO3-drl,drll.1,drll.2

Phenotype	Fish	Conditions	Figures
whole organism decreased length, abnormal	AB + MO3-drl,drll.1,drll.2	standard conditions	Fig. 2 from Pimtong et al., 2014
whole organism morphology, abnormal	AB + MO3-drl,drll.1,drll.2	standard conditions	Fig. 2 from Pimtong et al., 2014
whole organism drll.2 expression decreased amount, abnormal	AB + MO3-drl,drll.1,drll.2	standard conditions	Fig. 2 from Pimtong et al., 2014
convergent extension involved in axis elongation process quality, abnormal	AB + MO3-drl,drll.1,drll.2	standard conditions	Fig. 2 from Pimtong et al., 2014
whole organism drl expression decreased amount, abnormal	AB + MO3-drl,drll.1,drll.2	standard conditions	Fig. 2 from Pimtong et al., 2014
whole organism drll.1 expression decreased amount, abnormal	AB + MO3-drl,drll.1,drll.2	standard conditions	Fig. 2 from Pimtong et al., 2014
posterior lateral plate mesoderm npas4l expression decreased amount, abnormal	WT + MO3-drl,drll.1,drll.2	standard conditions	Fig. 3 from Kobayashi et al., 2019
dorsal aorta hematopoietic stem cell runx1 expression decreased distribution, abnormal	WT + MO3-drl,drll.1,drll.2	standard conditions	Fig. 3 from Kobayashi et al., 2019
nucleate erythrocyte gata1a expression decreased distribution, abnormal	WT + MO3-drl,drll.1,drll.2	standard conditions	Fig. 3 from Kobayashi et al., 2019
dorsal aorta fli1 expression decreased distribution, abnormal	WT + MO3-drl,drll.1,drll.2	standard conditions	Fig. 3 from Kobayashi et al., 2019

Citations