Morpholino

MO1-malat1

ID
ZDB-MRPHLNO-190212-2
Name
MO1-malat1
Previous Names
None
Target
Sequence
5' - CCACCAGGGTCTTTTGCTTTTTTTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-malat1
Expressed Gene Anatomy Figures
egr1 Fig. 6 from Wu et al., 2018
gata4 Fig. 6 from Wu et al., 2018
malat1 Fig. 4 with image from Wu et al., 2018
myh7 Fig. 6 from Wu et al., 2018
nkx2.5 Fig. 6 from Wu et al., 2018
Phenotype
Phenotype resulting from MO1-malat1
Phenotype Fish Figures
developmental growth delayed, abnormal WT + MO1-malat1 Fig. 5 with image from Wu et al., 2018
eye decreased size, abnormal WT + MO1-malat1 Fig. 5 with image from Wu et al., 2018
head malat1 expression absent, abnormal WT + MO1-malat1 Fig. 4 with image from Wu et al., 2018
otic vesicle decreased size, abnormal WT + MO1-malat1 Fig. 5 with image from Wu et al., 2018
otolith increased size, abnormal WT + MO1-malat1 Fig. 5 with image from Wu et al., 2018
pericardium edematous, abnormal WT + MO1-malat1 Fig. 5 with image from Wu et al., 2018
whole organism curved, abnormal WT + MO1-malat1 Fig. 5 with image from Wu et al., 2018
whole organism dead, abnormal WT + MO1-malat1 Fig. 4 with image from Wu et al., 2018
whole organism decreased pigmentation, abnormal WT + MO1-malat1 Fig. 5 with image from Wu et al., 2018
whole organism decreased size, abnormal WT + MO1-malat1 Fig. 5 with image from Wu et al., 2018
whole organism egr1 expression increased amount, abnormal WT + MO1-malat1 Fig. 6 from Wu et al., 2018
whole organism myh7 expression increased amount, abnormal WT + MO1-malat1 Fig. 6 from Wu et al., 2018
whole organism nkx2.5 expression increased amount, abnormal WT + MO1-malat1 Fig. 6 from Wu et al., 2018
whole organism gata4 expression increased amount, abnormal WT + MO1-malat1 Fig. 6 from Wu et al., 2018
whole organism morphology, abnormal WT + MO1-malat1 Fig. 4 with image from Wu et al., 2018
Phenotype of all Fish created by or utilizing MO1-malat1
Phenotype Fish Conditions Figures
developmental growth delayed, abnormal WT + MO1-malat1 control Fig. 5 with image from Wu et al., 2018
eye decreased size, abnormal WT + MO1-malat1 control Fig. 5 with image from Wu et al., 2018
pericardium edematous, abnormal WT + MO1-malat1 control Fig. 5 with image from Wu et al., 2018
whole organism myh7 expression increased amount, abnormal WT + MO1-malat1 control Fig. 6 from Wu et al., 2018
head malat1 expression absent, abnormal WT + MO1-malat1 control Fig. 4 with image from Wu et al., 2018
whole organism curved, abnormal WT + MO1-malat1 control Fig. 5 with image from Wu et al., 2018
otic vesicle decreased size, abnormal WT + MO1-malat1 control Fig. 5 with image from Wu et al., 2018
whole organism decreased size, abnormal WT + MO1-malat1 control Fig. 5 with image from Wu et al., 2018
whole organism morphology, abnormal WT + MO1-malat1 control Fig. 4 with image from Wu et al., 2018
otolith increased size, abnormal WT + MO1-malat1 control Fig. 5 with image from Wu et al., 2018
whole organism nkx2.5 expression increased amount, abnormal WT + MO1-malat1 control Fig. 6 from Wu et al., 2018
whole organism dead, abnormal WT + MO1-malat1 control Fig. 4 with image from Wu et al., 2018
whole organism decreased pigmentation, abnormal WT + MO1-malat1 control Fig. 5 with image from Wu et al., 2018
whole organism egr1 expression increased amount, abnormal WT + MO1-malat1 control Fig. 6 from Wu et al., 2018
whole organism gata4 expression increased amount, abnormal WT + MO1-malat1 control Fig. 6 from Wu et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.