Morpholino

MO3-kat2b

ID

ZDB-MRPHLNO-180625-1

Name

MO3-kat2b

Previous Names

None

Target

Sequence

5' - TCAGCCTGTGTGAAAACCAAACAGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-kat2b

Expressed Gene	Anatomy	Figures
kat2b	caudal fin head	Fig. 4 from Ghosh et al., 2017

Phenotype

Phenotype resulting from MO3-kat2b

Phenotype	Fish	Figures
atrium morphology, abnormal	WT + MO3-kat2b	Fig. 4 from Ghosh et al., 2017
atrium size, abnormal	WT + MO3-kat2b	Fig. 4 from Ghosh et al., 2017
cardiac ventricle morphology, abnormal	WT + MO3-kat2b	Fig. 4 from Ghosh et al., 2017
cardiac ventricle size, abnormal	WT + MO3-kat2b	Fig. 4 from Ghosh et al., 2017
heart morphology, abnormal	WT + MO3-kat2b	Fig. 4 from Ghosh et al., 2017
heart contraction decreased rate, abnormal	WT + MO3-kat2b	Fig. 4 from Ghosh et al., 2017
heart looping process quality, abnormal	WT + MO3-kat2b	Fig. 4 from Ghosh et al., 2017
paired fin absent, abnormal	WT + MO3-kat2b	Fig. 6 from Ghosh et al., 2017
paired fin decreased size, abnormal	WT + MO3-kat2b	Fig. 6 from Ghosh et al., 2017
paired fin morphology, abnormal	WT + MO3-kat2b	Fig. 6 from Ghosh et al., 2017
pericardium edematous, abnormal	WT + MO3-kat2b	Fig. 4 from Ghosh et al., 2017

Phenotype of all Fish created by or utilizing MO3-kat2b

Phenotype	Fish	Conditions	Figures
atrium size, abnormal	WT + MO3-kat2b	standard conditions	Fig. 4 from Ghosh et al., 2017
atrium morphology, abnormal	WT + MO3-kat2b	standard conditions	Fig. 4 from Ghosh et al., 2017
cardiac ventricle size, abnormal	WT + MO3-kat2b	standard conditions	Fig. 4 from Ghosh et al., 2017
pericardium edematous, abnormal	WT + MO3-kat2b	standard conditions	Fig. 4 from Ghosh et al., 2017
paired fin decreased size, abnormal	WT + MO3-kat2b	standard conditions	Fig. 6 from Ghosh et al., 2017
heart looping process quality, abnormal	WT + MO3-kat2b	standard conditions	Fig. 4 from Ghosh et al., 2017
paired fin morphology, abnormal	WT + MO3-kat2b	standard conditions	Fig. 6 from Ghosh et al., 2017
cardiac ventricle morphology, abnormal	WT + MO3-kat2b	standard conditions	Fig. 4 from Ghosh et al., 2017
paired fin absent, abnormal	WT + MO3-kat2b	standard conditions	Fig. 6 from Ghosh et al., 2017
heart contraction decreased rate, abnormal	WT + MO3-kat2b	standard conditions	Fig. 4 from Ghosh et al., 2017
heart morphology, abnormal	WT + MO3-kat2b	standard conditions	Fig. 4 from Ghosh et al., 2017

Citations