Morpholino

MO3-fer

ID
ZDB-MRPHLNO-180427-1
Name
MO3-fer
Previous Names
None
Target
Sequence
5' - CTGGAAGAGAGACAGAGATCACACT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-fer
Expressed Gene Anatomy Figures
fli1 Fig. 6 with image from Dunn et al., 2017
gata1a Fig. 4 with image,  Fig. 6 with image from Dunn et al., 2017
hbbe2 Fig. 4 with image,  Fig. 6 with image from Dunn et al., 2017
myb Fig. 4 with image,  Fig. 6 with image from Dunn et al., 2017
notch1a Fig. 4 with image from Dunn et al., 2017
notch1b Fig. 4 with image,  Fig. 6 with image from Dunn et al., 2017
runx1 Fig. 4 with image,  Fig. 6 with image from Dunn et al., 2017
tal1 Fig. 4 with image,  Fig. 6 with image from Dunn et al., 2017
Phenotype
Phenotype resulting from MO3-fer
Phenotype Fish Figures
blood circulation decreased occurrence, abnormal sd2Tg; y7Tg + MO3-fer Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Dunn et al., 2017
blood island gata1a expression increased distribution, abnormal AB + MO3-fer Fig. 6 with image from Dunn et al., 2017
blood island myb expression increased distribution, abnormal AB + MO3-fer Fig. 6 with image from Dunn et al., 2017
blood island tal1 expression increased distribution, abnormal AB + MO3-fer Fig. 6 with image from Dunn et al., 2017
blood island runx1 expression increased distribution, abnormal AB + MO3-fer Fig. 6 with image from Dunn et al., 2017
blood island hbbe2 expression increased distribution, abnormal AB + MO3-fer Fig. 6 with image from Dunn et al., 2017
circulating cell decreased amount, abnormal AB + MO3-fer Fig. 2 with image from Dunn et al., 2017
convergent extension process quality, abnormal AB + MO3-fer Fig. 2 with image from Dunn et al., 2017
dorsal aorta decreased diameter, abnormal y7Tg + MO3-fer Fig. 5 with image from Dunn et al., 2017
dorsal aorta anatomical region disorganized, abnormal y7Tg + MO3-fer Fig. 4 with image,  Fig. 5 with image from Dunn et al., 2017
dorsal aorta sprouting angiogenesis decreased occurrence, abnormal y7Tg + MO3-fer Fig. 5 with image from Dunn et al., 2017
endothelial cell decreased amount, abnormal sd2Tg; y7Tg + MO3-fer Fig. 5 with image from Dunn et al., 2017
heart nucleate erythrocyte absent, abnormal AB + MO3-fer Fig. 2 with image from Dunn et al., 2017
hematopoietic cell increased amount, abnormal sd2Tg; y7Tg + MO3-fer Fig. 5 with image from Dunn et al., 2017
hematopoietic cell blood circulation decreased occurrence, abnormal sd2Tg; y7Tg + MO3-fer Fig. 4 with image from Dunn et al., 2017
intersegmental vessel malformed, abnormal sd2Tg; y7Tg + MO3-fer Fig. 4 with image from Dunn et al., 2017
intersegmental vessel endothelial cell decreased amount, abnormal y7Tg + MO3-fer Fig. 5 with image from Dunn et al., 2017
lateral plate mesoderm tal1 expression spatial pattern, abnormal AB + MO3-fer Fig. 6 with image from Dunn et al., 2017
lateral plate mesoderm gata1a expression spatial pattern, abnormal AB + MO3-fer Fig. 6 with image from Dunn et al., 2017
nucleate erythrocyte increased accumulation intermediate cell mass of mesoderm posterior region, abnormal AB + MO3-fer Fig. 2 with image from Dunn et al., 2017
pericardium edematous, abnormal AB + MO3-fer Fig. 2 with image from Dunn et al., 2017
posterior cardinal vein anatomical region disorganized, abnormal sd2Tg; y7Tg + MO3-fer Fig. 4 with image from Dunn et al., 2017
posterior lateral plate mesoderm runx1 expression decreased amount, abnormal AB + MO3-fer Fig. 6 with image from Dunn et al., 2017
trunk notch1b expression increased amount, abnormal AB + MO3-fer Fig. 6 with image from Dunn et al., 2017
trunk nucleate erythrocyte increased amount, abnormal AB + MO3-fer Fig. 3 with image from Dunn et al., 2017
whole organism notch1b expression decreased amount, abnormal AB + MO3-fer Fig. 4 with image from Dunn et al., 2017
whole organism notch1a expression decreased amount, abnormal AB + MO3-fer Fig. 4 with image from Dunn et al., 2017
whole organism runx1 expression decreased amount, abnormal AB + MO3-fer Fig. 4 with image from Dunn et al., 2017
whole organism myb expression increased amount, abnormal AB + MO3-fer Fig. 4 with image from Dunn et al., 2017
whole organism hbbe2 expression increased amount, abnormal AB + MO3-fer Fig. 4 with image from Dunn et al., 2017
whole organism tal1 expression increased amount, abnormal AB + MO3-fer Fig. 4 with image from Dunn et al., 2017
whole organism notch1b expression increased amount, abnormal AB + MO3-fer Fig. 4 with image from Dunn et al., 2017
whole organism notch1a expression increased amount, abnormal AB + MO3-fer Fig. 4 with image from Dunn et al., 2017
whole organism gata1a expression increased amount, abnormal AB + MO3-fer Fig. 4 with image from Dunn et al., 2017
whole organism anterior region lacks parts or has fewer parts of type nucleate erythrocyte, abnormal AB + MO3-fer Fig. 3 with image from Dunn et al., 2017
whole organism posterior region lacks parts or has fewer parts of type nucleate erythrocyte, abnormal AB + MO3-fer Fig. 3 with image from Dunn et al., 2017
Phenotype of all Fish created by or utilizing MO3-fer
Phenotype Fish Conditions Figures
whole organism notch1a expression decreased amount, abnormal AB + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
circulating cell decreased amount, abnormal AB + MO3-fer standard conditions Fig. 2 with image from Dunn et al., 2017
lateral plate mesoderm gata1a expression spatial pattern, abnormal AB + MO3-fer standard conditions Fig. 6 with image from Dunn et al., 2017
whole organism runx1 expression decreased amount, abnormal AB + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
whole organism tal1 expression increased amount, abnormal AB + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
blood island runx1 expression increased distribution, abnormal AB + MO3-fer standard conditions Fig. 6 with image from Dunn et al., 2017
lateral plate mesoderm tal1 expression spatial pattern, abnormal AB + MO3-fer standard conditions Fig. 6 with image from Dunn et al., 2017
blood island hbbe2 expression increased distribution, abnormal AB + MO3-fer standard conditions Fig. 6 with image from Dunn et al., 2017
whole organism notch1b expression decreased amount, abnormal AB + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
whole organism hbbe2 expression increased amount, abnormal AB + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
blood island tal1 expression increased distribution, abnormal AB + MO3-fer standard conditions Fig. 6 with image from Dunn et al., 2017
trunk notch1b expression increased amount, abnormal AB + MO3-fer standard conditions Fig. 6 with image from Dunn et al., 2017
nucleate erythrocyte increased accumulation intermediate cell mass of mesoderm posterior region, abnormal AB + MO3-fer standard conditions Fig. 2 with image from Dunn et al., 2017
whole organism notch1b expression increased amount, abnormal AB + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
whole organism myb expression increased amount, abnormal AB + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
heart nucleate erythrocyte absent, abnormal AB + MO3-fer standard conditions Fig. 2 with image from Dunn et al., 2017
whole organism posterior region lacks parts or has fewer parts of type nucleate erythrocyte, abnormal AB + MO3-fer standard conditions Fig. 3 with image from Dunn et al., 2017
pericardium edematous, abnormal AB + MO3-fer standard conditions Fig. 2 with image from Dunn et al., 2017
whole organism anterior region lacks parts or has fewer parts of type nucleate erythrocyte, abnormal AB + MO3-fer standard conditions Fig. 3 with image from Dunn et al., 2017
whole organism gata1a expression increased amount, abnormal AB + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
whole organism notch1a expression increased amount, abnormal AB + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
blood circulation decreased occurrence, abnormal AB + MO3-fer standard conditions Fig. 3 with image from Dunn et al., 2017
convergent extension process quality, abnormal AB + MO3-fer standard conditions Fig. 2 with image from Dunn et al., 2017
posterior lateral plate mesoderm runx1 expression decreased amount, abnormal AB + MO3-fer standard conditions Fig. 6 with image from Dunn et al., 2017
blood island myb expression increased distribution, abnormal AB + MO3-fer standard conditions Fig. 6 with image from Dunn et al., 2017
blood island gata1a expression increased distribution, abnormal AB + MO3-fer standard conditions Fig. 6 with image from Dunn et al., 2017
trunk nucleate erythrocyte increased amount, abnormal AB + MO3-fer standard conditions Fig. 3 with image from Dunn et al., 2017
intersegmental vessel endothelial cell decreased amount, abnormal y7Tg + MO3-fer standard conditions Fig. 5 with image from Dunn et al., 2017
dorsal aorta decreased diameter, abnormal y7Tg + MO3-fer standard conditions Fig. 5 with image from Dunn et al., 2017
dorsal aorta sprouting angiogenesis decreased occurrence, abnormal y7Tg + MO3-fer standard conditions Fig. 5 with image from Dunn et al., 2017
blood circulation decreased occurrence, abnormal y7Tg + MO3-fer standard conditions Fig. 5 with image from Dunn et al., 2017
dorsal aorta anatomical region disorganized, abnormal y7Tg + MO3-fer standard conditions Fig. 5 with image from Dunn et al., 2017
posterior cardinal vein anatomical region disorganized, abnormal sd2Tg; y7Tg + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
hematopoietic cell blood circulation decreased occurrence, abnormal sd2Tg; y7Tg + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
endothelial cell decreased amount, abnormal sd2Tg; y7Tg + MO3-fer standard conditions Fig. 5 with image from Dunn et al., 2017
hematopoietic cell increased amount, abnormal sd2Tg; y7Tg + MO3-fer standard conditions Fig. 5 with image from Dunn et al., 2017
intersegmental vessel malformed, abnormal sd2Tg; y7Tg + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
blood circulation decreased occurrence, abnormal sd2Tg; y7Tg + MO3-fer standard conditions Fig. 4 with image,  Fig. 5 with image from Dunn et al., 2017
dorsal aorta anatomical region disorganized, abnormal sd2Tg; y7Tg + MO3-fer standard conditions Fig. 4 with image from Dunn et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.