Morpholino

MO1-cfdp1

ID

ZDB-MRPHLNO-180425-1

Name

MO1-cfdp1

Previous Names

MO1-cfpd1

Target

cfdp1 (1)

Sequence

5' - GCGCTGTAGAATTAGCTGCTAAATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-cfdp1

Expressed Gene	Anatomy	Figures
cfdp1	whole organism	Fig. 6 from Celauro et al., 2017

Phenotype

Phenotype resulting from MO1-cfdp1

Phenotype	Fish	Figures
bone mineralization decreased process quality, abnormal	AB + MO1-cfdp1	Fig. 8 from Celauro et al., 2017
ceratobranchial cartilage disorganized, abnormal	AB + MO1-cfdp1	Fig. 8 from Celauro et al., 2017
ceratohyal cartilage shape, abnormal	AB + MO1-cfdp1	Fig. 8 from Celauro et al., 2017
cleithrum bone mineralization decreased process quality, abnormal	AB + MO1-cfdp1	Fig. 8 from Celauro et al., 2017
cranial skeletal system development disrupted, abnormal	AB + MO1-cfdp1	Fig. 8 from Celauro et al., 2017
feeding behavior process quality, abnormal	AB + MO1-cfdp1	Fig. Video 1 from Celauro et al., 2017
Meckel's cartilage morphology, abnormal	AB + MO1-cfdp1	Fig. 8 from Celauro et al., 2017
mouth shape, abnormal	AB + MO1-cfdp1	Fig. 6, Fig. 8 from Celauro et al., 2017
opercle bone mineralization decreased process quality, abnormal	AB + MO1-cfdp1	Fig. 8 from Celauro et al., 2017
otolith fused with otolith, abnormal	AB + MO1-cfdp1	Fig. 6 from Celauro et al., 2017
otolith morphology, abnormal	AB + MO1-cfdp1	Fig. 6 from Celauro et al., 2017
post-vent region increased curvature, abnormal	AB + MO1-cfdp1	Fig. 7 from Celauro et al., 2017
swim bladder aplastic, abnormal	AB + MO1-cfdp1	Fig. 6 from Celauro et al., 2017
swimming behavior process quality, abnormal	AB + MO1-cfdp1	Fig. Video 1 from Celauro et al., 2017
whole organism cfdp1 expression decreased amount, abnormal	AB + MO1-cfdp1	Fig. 6 from Celauro et al., 2017

Phenotype of all Fish created by or utilizing MO1-cfdp1

Phenotype	Fish	Conditions	Figures
post-vent region increased curvature, abnormal	AB + MO1-cfdp1	control	Fig. 7 from Celauro et al., 2017
swimming behavior process quality, abnormal	AB + MO1-cfdp1	control	Fig. Video 1 from Celauro et al., 2017
ceratohyal cartilage shape, abnormal	AB + MO1-cfdp1	control	Fig. 8 from Celauro et al., 2017
mouth shape, abnormal	AB + MO1-cfdp1	control	Fig. 6, Fig. 8 from Celauro et al., 2017
swim bladder aplastic, abnormal	AB + MO1-cfdp1	control	Fig. 6 from Celauro et al., 2017
cleithrum bone mineralization decreased process quality, abnormal	AB + MO1-cfdp1	control	Fig. 8 from Celauro et al., 2017
bone mineralization decreased process quality, abnormal	AB + MO1-cfdp1	control	Fig. 8 from Celauro et al., 2017
ceratobranchial cartilage disorganized, abnormal	AB + MO1-cfdp1	control	Fig. 8 from Celauro et al., 2017
otolith fused with otolith, abnormal	AB + MO1-cfdp1	control	Fig. 6 from Celauro et al., 2017
Meckel's cartilage morphology, abnormal	AB + MO1-cfdp1	control	Fig. 8 from Celauro et al., 2017
opercle bone mineralization decreased process quality, abnormal	AB + MO1-cfdp1	control	Fig. 8 from Celauro et al., 2017
feeding behavior process quality, abnormal	AB + MO1-cfdp1	control	Fig. Video 1 from Celauro et al., 2017
cranial skeletal system development disrupted, abnormal	AB + MO1-cfdp1	control	Fig. 8 from Celauro et al., 2017
otolith morphology, abnormal	AB + MO1-cfdp1	control	Fig. 6 from Celauro et al., 2017
whole organism cfdp1 expression decreased amount, abnormal	AB + MO1-cfdp1	control	Fig. 6 from Celauro et al., 2017

Citations