Morpholino

MO3-flcn

ID

ZDB-MRPHLNO-171211-3

Name

MO3-flcn

Previous Names

splice2 MO (1)

Target

flcn (1)

Sequence

5' - CGTTCATCTGGAGGAAACAAACATA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-flcn

No data available

Phenotype

Phenotype resulting from MO3-flcn

Phenotype	Fish	Figures
ball increased size, abnormal	AB + MO3-flcn	Fig. 2 from Kenyon et al., 2016
brain edematous, abnormal	AB + MO3-flcn	Fig. 2 from Kenyon et al., 2016
brain cell death increased occurrence, abnormal	AB + MO3-flcn	Fig. 2 from Kenyon et al., 2016
brain nucleus Venus expression decreased amount, abnormal	ncv3Tg; ncv4Tg + MO3-flcn	Fig. 3 from Kenyon et al., 2016
brain nucleus mCherry expression increased amount, abnormal	ncv3Tg; ncv4Tg + MO3-flcn	Fig. 3 , Fig. 4 from Kenyon et al., 2016
brain regulation of cell cycle decreased process quality, abnormal	ncv3Tg; ncv4Tg + MO3-flcn	Fig. 3 , Fig. 4 from Kenyon et al., 2016
embryo development delayed, abnormal	AB + MO3-flcn	Fig. 2 from Kenyon et al., 2016
extension decreased thickness, abnormal	AB + MO3-flcn	Fig. 2 from Kenyon et al., 2016
optic vesicle nucleus Venus expression decreased amount, abnormal	ncv3Tg; ncv4Tg + MO3-flcn	Fig. 3 from Kenyon et al., 2016
optic vesicle nucleus mCherry expression increased amount, abnormal	ncv3Tg; ncv4Tg + MO3-flcn	Fig. 3 , Fig. 4 from Kenyon et al., 2016
post-vent region notochord bent, abnormal	AB + MO3-flcn	Fig. 2 from Kenyon et al., 2016
retina regulation of cell cycle decreased process quality, abnormal	ncv3Tg; ncv4Tg + MO3-flcn	Fig. 3 , Fig. 4 from Kenyon et al., 2016
somite U-shaped, abnormal	AB + MO3-flcn	Fig. 2 from Kenyon et al., 2016
trunk cell death increased occurrence, abnormal	AB + MO3-flcn	Fig. 2 from Kenyon et al., 2016

Phenotype of all Fish created by or utilizing MO3-flcn

Phenotype	Fish	Conditions	Figures
embryo development delayed, abnormal	AB + MO3-flcn	standard conditions	Fig. 2 from Kenyon et al., 2016
somite U-shaped, abnormal	AB + MO3-flcn	standard conditions	Fig. 2 from Kenyon et al., 2016
post-vent region notochord bent, abnormal	AB + MO3-flcn	standard conditions	Fig. 2 from Kenyon et al., 2016
trunk cell death increased occurrence, abnormal	AB + MO3-flcn	standard conditions	Fig. 2 from Kenyon et al., 2016
extension decreased thickness, abnormal	AB + MO3-flcn	standard conditions	Fig. 2 from Kenyon et al., 2016
brain cell death increased occurrence, abnormal	AB + MO3-flcn	standard conditions	Fig. 2 from Kenyon et al., 2016
ball increased size, abnormal	AB + MO3-flcn	standard conditions	Fig. 2 from Kenyon et al., 2016
brain edematous, abnormal	AB + MO3-flcn	standard conditions	Fig. 2 from Kenyon et al., 2016
brain nucleus mCherry expression increased amount, abnormal	ncv3Tg; ncv4Tg + MO3-flcn	standard conditions	Fig. 3 , Fig. 4 from Kenyon et al., 2016
optic vesicle nucleus Venus expression decreased amount, abnormal	ncv3Tg; ncv4Tg + MO3-flcn	standard conditions	Fig. 3 from Kenyon et al., 2016
retina regulation of cell cycle decreased process quality, abnormal	ncv3Tg; ncv4Tg + MO3-flcn	standard conditions	Fig. 3 , Fig. 4 from Kenyon et al., 2016
brain regulation of cell cycle decreased process quality, abnormal	ncv3Tg; ncv4Tg + MO3-flcn	standard conditions	Fig. 3 , Fig. 4 from Kenyon et al., 2016
optic vesicle nucleus mCherry expression increased amount, abnormal	ncv3Tg; ncv4Tg + MO3-flcn	standard conditions	Fig. 3 , Fig. 4 from Kenyon et al., 2016
brain nucleus Venus expression decreased amount, abnormal	ncv3Tg; ncv4Tg + MO3-flcn	standard conditions	Fig. 3 from Kenyon et al., 2016

Citations