Morpholino

MO3-sting1

ID
ZDB-MRPHLNO-171109-1
Name
MO3-sting1
Previous Names
  • MO3-tmem173
Target
Sequence
5' - GAGCGTCTTCTCCCATCACAGACAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sting1
No data available
Phenotype
Phenotype resulting from MO3-sting1
Phenotype Fish Figures
positive regulation of non-canonical NF-kappaB signal transduction disrupted, abnormal AB + MO3-sting1 Fig. 6 from Ma et al., 2018
trunk shortened, abnormal WT + MO3-sting1 Fig. 5 from Ge et al., 2015
whole organism decreased pigmentation, abnormal WT + MO3-sting1 Fig. 5 from Ge et al., 2015
Phenotype of all Fish created by or utilizing MO3-sting1
Phenotype Fish Conditions Figures
innate immune response disrupted, abnormal AB + MO3-sting1 bacterial treatment by exposure to environment: Edwardsiella tarda Fig. 10 from Ma et al., 2018
whole organism decreased life span, abnormal AB + MO3-sting1 bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 10 from Ma et al., 2018
positive regulation of non-canonical NF-kappaB signal transduction disrupted, abnormal AB + MO3-sting1 standard conditions Fig. 6 from Ma et al., 2018
innate immune response disrupted, abnormal AB + MO3-sting1 bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 10 from Ma et al., 2018
whole organism decreased life span, abnormal AB + MO3-sting1 bacterial treatment by exposure to environment: Edwardsiella tarda Fig. 10 from Ma et al., 2018
whole organism isg15 expression amount, ameliorated WT + MO3-sting1 viral treatment by injection: Human alphaherpesvirus 1 Fig. 4,  Fig. 5 from Ge et al., 2015
trunk shortened, abnormal WT + MO3-sting1 standard conditions Fig. 5 from Ge et al., 2015
trunk shortened, abnormal WT + MO3-sting1 viral treatment by injection: Human alphaherpesvirus 1 Fig. 4 from Ge et al., 2015
head kidney il1b expression amount, ameliorated WT + MO3-sting1 bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism ifnphi3 expression amount, ameliorated WT + MO3-sting1 bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism rsad2 expression amount, ameliorated WT + MO3-sting1 viral treatment by injection: Human alphaherpesvirus 1 Fig. 4,  Fig. 5 from Ge et al., 2015
head kidney irf3 expression amount, ameliorated WT + MO3-sting1 bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
head kidney hamp expression amount, ameliorated WT + MO3-sting1 bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
head kidney ifnphi1 expression amount, ameliorated WT + MO3-sting1 bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism dead, exacerbated WT + MO3-sting1 bacterial treatment by exposure to environment: Edwardsiella tarda Fig. 9 from Liu et al., 2020
whole organism ifnphi1 expression amount, ameliorated WT + MO3-sting1 viral treatment by injection: Human alphaherpesvirus 1 Fig. 4,  Fig. 5 from Ge et al., 2015
head kidney il6 expression amount, ameliorated WT + MO3-sting1 bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism decreased life span, exacerbated WT + MO3-sting1 viral treatment by injection: Human alphaherpesvirus 1 Fig. 4,  Fig. 5 from Ge et al., 2015
whole organism dead, exacerbated WT + MO3-sting1 viral treatment by exposure to environment: Rhabdoviridae Fig. 9 from Liu et al., 2020
whole organism il1b expression amount, ameliorated WT + MO3-sting1 bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism decreased pigmentation, abnormal WT + MO3-sting1 viral treatment by injection: Human alphaherpesvirus 1 Fig. 4 from Ge et al., 2015
whole organism irf3 expression amount, ameliorated WT + MO3-sting1 bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism ifnphi1 expression amount, ameliorated WT + MO3-sting1 bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
head kidney ifnphi3 expression amount, ameliorated WT + MO3-sting1 bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism hamp expression amount, ameliorated WT + MO3-sting1 bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism decreased pigmentation, abnormal WT + MO3-sting1 standard conditions Fig. 5 from Ge et al., 2015
whole organism il6 expression amount, ameliorated WT + MO3-sting1 bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism dead, exacerbated WT + MO3-sting1 bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.