Morpholino

MO1-blzf1

ID

ZDB-MRPHLNO-170817-3

Name

MO1-blzf1

Previous Names

Golgin45MO (1)

Target

blzf1 (1)

Sequence

5' - CCTTTTCCACTTCCAGAACACAACA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-blzf1

No data available

Phenotype

Phenotype resulting from MO1-blzf1

Phenotype	Fish	Figures
fast muscle cell disorganized, abnormal	WT + MO1-blzf1	Fig. S4 from Cao et al., 2016
muscle cell disorganized, abnormal	WT + MO1-blzf1	Fig. 3 , Fig. 4 , Fig. S2 from Cao et al., 2016
slow muscle cell disorganized, abnormal	WT + MO1-blzf1	Fig. 4 from Cao et al., 2016
slow muscle cell ab-f59 labeling spatial pattern, abnormal	WT + MO1-blzf1	Fig. 4 from Cao et al., 2016
somite disorganized, abnormal	WT + MO1-blzf1	Fig. 3 from Cao et al., 2016
somite sarcomere absent, abnormal	WT + MO1-blzf1	Fig. S2 from Cao et al., 2016
somite border ab1-dmd labeling spatial pattern, abnormal	WT + MO1-blzf1	Fig. 4 from Cao et al., 2016
vertical myoseptum disorganized, abnormal	WT + MO1-blzf1	Fig. S2 from Cao et al., 2016
vertical myoseptum morphology, abnormal	WT + MO1-blzf1	Fig. 4 from Cao et al., 2016
whole organism anterior-posterior axis decreased length, abnormal	WT + MO1-blzf1	Fig. 3 from Cao et al., 2016

Phenotype of all Fish created by or utilizing MO1-blzf1

Phenotype	Fish	Conditions	Figures
fast muscle cell disorganized, abnormal	WT + MO1-blzf1	standard conditions	Fig. S4 from Cao et al., 2016
vertical myoseptum disorganized, abnormal	WT + MO1-blzf1	standard conditions	Fig. S2 from Cao et al., 2016
somite border ab1-dmd labeling spatial pattern, abnormal	WT + MO1-blzf1	standard conditions	Fig. 4 from Cao et al., 2016
muscle cell disorganized, abnormal	WT + MO1-blzf1	standard conditions	Fig. 3 , Fig. 4 , Fig. S2 from Cao et al., 2016
myoblast cell-matrix adhesion arrested, abnormal	WT + MO1-blzf1	primary cell culture: somite	Fig. 6 from Cao et al., 2016
myoblast cell-matrix adhesion decreased occurrence, abnormal	WT + MO1-blzf1	primary cell culture: somite	Fig. 6 from Cao et al., 2016
somite disorganized, abnormal	WT + MO1-blzf1	standard conditions	Fig. 3 from Cao et al., 2016
myoblast Golgi apparatus morphology, abnormal	WT + MO1-blzf1	primary cell culture: somite	Fig. 7 from Cao et al., 2016
somite sarcomere absent, abnormal	WT + MO1-blzf1	standard conditions	Fig. S2 from Cao et al., 2016
slow muscle cell ab-f59 labeling spatial pattern, abnormal	WT + MO1-blzf1	standard conditions	Fig. 4 from Cao et al., 2016
slow muscle cell disorganized, abnormal	WT + MO1-blzf1	standard conditions	Fig. 4 from Cao et al., 2016
whole organism anterior-posterior axis decreased length, abnormal	WT + MO1-blzf1	standard conditions	Fig. 3 from Cao et al., 2016
vertical myoseptum morphology, abnormal	WT + MO1-blzf1	standard conditions	Fig. 4 from Cao et al., 2016
slow muscle cell ab-f59 labeling spatial pattern, abnormal	WT + MO1-blzf1 + MO1-myo18ab	standard conditions	Fig. 4 from Cao et al., 2016
somite border ab1-dmd labeling spatial pattern, abnormal	WT + MO1-blzf1 + MO1-myo18ab	standard conditions	Fig. 4 from Cao et al., 2016
muscle cell disorganized, exacerbated	WT + MO1-blzf1 + MO1-myo18ab	standard conditions	Fig. 4 from Cao et al., 2016
slow muscle cell disorganized, exacerbated	WT + MO1-blzf1 + MO1-myo18ab	standard conditions	Fig. 4 from Cao et al., 2016
vertical myoseptum morphology, exacerbated	WT + MO1-blzf1 + MO1-myo18ab	standard conditions	Fig. 4 from Cao et al., 2016

Citations