Morpholino

MO3-flot2a

ID

ZDB-MRPHLNO-170627-1

Name

MO3-flot2a

Previous Names

MoATGFlot2 (1)

Target

flot2a (1)

Sequence

5' - ACCGTGTAGCAATTCCCCATTTTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-flot2a

No data available

Phenotype

Phenotype resulting from MO3-flot2a

Phenotype	Fish	Figures
blastomere organization quality, abnormal	AB + MO3-flot2a	Fig. 1 from Morris et al., 2017
caudal fin morphology, abnormal	AB + MO3-flot2a	Fig. 1 from Morris et al., 2017
DEL cell migration involved in gastrulation delayed, abnormal	AB + MO3-flot2a	Fig. 2 from Morris et al., 2017
DEL cell migration involved in gastrulation process quality, abnormal	AB + MO3-flot2a	Fig. 2 from Morris et al., 2017
DEL cell-cell junction ab2-cdh1 labeling decreased amount, abnormal	AB + MO3-flot2a	Fig. 3 from Morris et al., 2017
DEL cell-cell junction ab2-ctnnb labeling decreased amount, abnormal	AB + MO3-flot2a	Fig. 3 from Morris et al., 2017
epiboly involved in gastrulation with mouth forming second arrested, abnormal	AB + MO3-flot2a	Fig. 1 from Morris et al., 2017
epiboly involved in gastrulation with mouth forming second delayed, abnormal	AB + MO3-flot2a	Fig. 1 from Morris et al., 2017
whole organism ab2-cdh1 labeling decreased amount, abnormal	AB + MO3-flot2a	Fig. 3 from Morris et al., 2017
whole organism Ab1-flot2 labeling decreased amount, abnormal	AB + MO3-flot2a	Fig. 1, Fig. 3 from Morris et al., 2017
whole organism anterior-posterior axis decreased length, abnormal	AB + MO3-flot2a	Fig. 1 from Morris et al., 2017

Phenotype of all Fish created by or utilizing MO3-flot2a

Phenotype	Fish	Conditions	Figures
caudal fin morphology, abnormal	AB + MO3-flot2a	standard conditions	Fig. 1 from Morris et al., 2017
whole organism ab2-cdh1 labeling decreased amount, abnormal	AB + MO3-flot2a	standard conditions	Fig. 3 from Morris et al., 2017
blastomere organization quality, abnormal	AB + MO3-flot2a	standard conditions	Fig. 1 from Morris et al., 2017
DEL cell-cell junction ab2-cdh1 labeling decreased amount, abnormal	AB + MO3-flot2a	standard conditions	Fig. 3 from Morris et al., 2017
whole organism Ab1-flot2 labeling decreased amount, abnormal	AB + MO3-flot2a	standard conditions	Fig. 1, Fig. 3 from Morris et al., 2017
epiboly involved in gastrulation with mouth forming second delayed, abnormal	AB + MO3-flot2a	standard conditions	Fig. 1 from Morris et al., 2017
epiboly involved in gastrulation with mouth forming second arrested, abnormal	AB + MO3-flot2a	standard conditions	Fig. 1 from Morris et al., 2017
DEL cell migration involved in gastrulation delayed, abnormal	AB + MO3-flot2a	standard conditions	Fig. 2 from Morris et al., 2017
whole organism Ab1-flot2 labeling decreased amount, abnormal	AB + MO3-flot2a	chemical treatment: ilomastat	Fig. 3 from Morris et al., 2017
DEL cell migration involved in gastrulation process quality, abnormal	AB + MO3-flot2a	standard conditions	Fig. 2 from Morris et al., 2017
whole organism anterior-posterior axis decreased length, abnormal	AB + MO3-flot2a	standard conditions	Fig. 1 from Morris et al., 2017
DEL cell-cell junction ab2-ctnnb labeling decreased amount, abnormal	AB + MO3-flot2a	standard conditions	Fig. 3 from Morris et al., 2017
whole organism ab2-cdh1 labeling amount, ameliorated	AB + MO3-flot2a	chemical treatment: ilomastat	Fig. 3 from Morris et al., 2017

Citations