Morpholino

MO3-pou3f2b

ID

ZDB-MRPHLNO-170601-3

Name

MO3-pou3f2b

Previous Names

None

Target

Sequence

5' - CGGACTGATCGCTCCTATTAAAGGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-pou3f2b

Expressed Gene	Anatomy	Figures
fli1	intersegmental vessel trunk vasculature	Fig. 4 from Wong et al., 2017
kdr	intersegmental vessel trunk vasculature	Fig. 4 from Wong et al., 2017

Phenotype

Phenotype resulting from MO3-pou3f2b

Phenotype	Fish	Figures
caudal fin curled, abnormal	WIK + MO3-pou3f2b	Fig. 4 from Wong et al., 2017
endothelial cell decreased amount, abnormal	y1Tg + MO3-pou3f2b	Fig. 4 from Wong et al., 2017
intersegmental vessel kdr expression decreased amount, abnormal	WIK + MO3-pou3f2b	Fig. 4 from Wong et al., 2017
intersegmental vessel fli1 expression decreased amount, abnormal	WIK + MO3-pou3f2b	Fig. 4 from Wong et al., 2017
intersegmental vessel decreased amount, abnormal	y1Tg + MO3-pou3f2b	Fig. 4 from Wong et al., 2017
trunk vasculature fli1 expression decreased amount, abnormal	WIK + MO3-pou3f2b	Fig. 4 from Wong et al., 2017
trunk vasculature kdr expression decreased amount, abnormal	WIK + MO3-pou3f2b	Fig. 4 from Wong et al., 2017
trunk vasculature morphology, abnormal	y1Tg + MO3-pou3f2b	Fig. 4 from Wong et al., 2017
whole organism curved, abnormal	WIK + MO3-pou3f2b	Fig. 4 from Wong et al., 2017

Phenotype of all Fish created by or utilizing MO3-pou3f2b

Phenotype	Fish	Conditions	Figures
trunk vasculature kdr expression decreased amount, abnormal	WIK + MO3-pou3f2b	standard conditions	Fig. 4 from Wong et al., 2017
intersegmental vessel fli1 expression decreased amount, abnormal	WIK + MO3-pou3f2b	standard conditions	Fig. 4 from Wong et al., 2017
trunk vasculature fli1 expression decreased amount, abnormal	WIK + MO3-pou3f2b	standard conditions	Fig. 4 from Wong et al., 2017
intersegmental vessel kdr expression decreased amount, abnormal	WIK + MO3-pou3f2b	standard conditions	Fig. 4 from Wong et al., 2017
caudal fin curled, abnormal	WIK + MO3-pou3f2b	standard conditions	Fig. 4 from Wong et al., 2017
whole organism curved, abnormal	WIK + MO3-pou3f2b	standard conditions	Fig. 4 from Wong et al., 2017
trunk vasculature morphology, abnormal	y1Tg + MO3-pou3f2b	standard conditions	Fig. 4 from Wong et al., 2017
endothelial cell decreased amount, abnormal	y1Tg + MO3-pou3f2b	standard conditions	Fig. 4 from Wong et al., 2017
intersegmental vessel decreased amount, abnormal	y1Tg + MO3-pou3f2b	standard conditions	Fig. 4 from Wong et al., 2017

Citations