Morpholino

MO1-ece1

ID

ZDB-MRPHLNO-170512-1

Name

MO1-ece1

Previous Names

None

Target

ece1 (1)

Sequence

5' - AAGTAGACATCTGAGGGAAATGTAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ece1

No data available

Phenotype

Phenotype resulting from MO1-ece1

Phenotype	Fish	Figures
basihyal cartilage curved ventral, abnormal	WT + MO1-ece1 + MO4-tp53	Fig. 2 from Iklé et al., 2017
basihyal cartilage decreased size, abnormal	WT + MO1-ece1 + MO4-tp53	Fig. 2 from Iklé et al., 2017
ceratobranchial cartilage decreased amount, abnormal	WT + MO1-ece1 + MO4-tp53	Fig. 2 from Iklé et al., 2017
ceratohyal cartilage curved ventral, abnormal	WT + MO1-ece1 + MO4-tp53	Fig. 2 from Iklé et al., 2017
ceratohyal cartilage decreased size, abnormal	WT + MO1-ece1 + MO4-tp53	Fig. 2 from Iklé et al., 2017
ceratohyal cartilage fused with hyosymplectic cartilage, abnormal	WT + MO1-ece1 + MO4-tp53	Fig. 2 from Iklé et al., 2017
hyosymplectic cartilage hypoplastic, abnormal	WT + MO1-ece1 + MO4-tp53	Fig. 2 from Iklé et al., 2017
Meckel's cartilage curved ventral, abnormal	WT + MO1-ece1 + MO4-tp53	Fig. 2 from Iklé et al., 2017
Meckel's cartilage fused with palatoquadrate cartilage, abnormal	WT + MO1-ece1 + MO4-tp53	Fig. 2 from Iklé et al., 2017
Meckel's cartilage fused with Meckel's cartilage, abnormal	WT + MO1-ece1 + MO4-tp53	Fig. 2 from Iklé et al., 2017
palatoquadrate cartilage hypoplastic, abnormal	WT + MO1-ece1 + MO4-tp53	Fig. 2 from Iklé et al., 2017
pharyngeal arch 1 dlx5a expression decreased distribution, abnormal	WT + MO1-ece1 + MO4-tp53	Fig. 2 from Iklé et al., 2017
pharyngeal arch 2 dlx5a expression decreased distribution, abnormal	WT + MO1-ece1 + MO4-tp53	Fig. 2 from Iklé et al., 2017

Phenotype of all Fish created by or utilizing MO1-ece1

Phenotype	Fish	Conditions	Figures
ceratohyal cartilage decreased size, abnormal	WT + MO1-ece1 + MO4-tp53	standard conditions	Fig. 2 from Iklé et al., 2017
ceratobranchial cartilage decreased amount, abnormal	WT + MO1-ece1 + MO4-tp53	standard conditions	Fig. 2 from Iklé et al., 2017
ceratohyal cartilage fused with hyosymplectic cartilage, abnormal	WT + MO1-ece1 + MO4-tp53	standard conditions	Fig. 2 from Iklé et al., 2017
basihyal cartilage decreased size, abnormal	WT + MO1-ece1 + MO4-tp53	standard conditions	Fig. 2 from Iklé et al., 2017
pharyngeal arch 1 dlx5a expression decreased distribution, abnormal	WT + MO1-ece1 + MO4-tp53	standard conditions	Fig. 2 from Iklé et al., 2017
pharyngeal arch 2 dlx5a expression decreased distribution, abnormal	WT + MO1-ece1 + MO4-tp53	standard conditions	Fig. 2 from Iklé et al., 2017
Meckel's cartilage curved ventral, abnormal	WT + MO1-ece1 + MO4-tp53	standard conditions	Fig. 2 from Iklé et al., 2017
Meckel's cartilage fused with Meckel's cartilage, abnormal	WT + MO1-ece1 + MO4-tp53	standard conditions	Fig. 2 from Iklé et al., 2017
Meckel's cartilage fused with palatoquadrate cartilage, abnormal	WT + MO1-ece1 + MO4-tp53	standard conditions	Fig. 2 from Iklé et al., 2017
ceratohyal cartilage curved ventral, abnormal	WT + MO1-ece1 + MO4-tp53	standard conditions	Fig. 2 from Iklé et al., 2017
basihyal cartilage curved ventral, abnormal	WT + MO1-ece1 + MO4-tp53	standard conditions	Fig. 2 from Iklé et al., 2017
hyosymplectic cartilage hypoplastic, abnormal	WT + MO1-ece1 + MO4-tp53	standard conditions	Fig. 2 from Iklé et al., 2017
palatoquadrate cartilage hypoplastic, abnormal	WT + MO1-ece1 + MO4-tp53	standard conditions	Fig. 2 from Iklé et al., 2017

Citations