Morpholino

MO3-cyp19a1b

ID
ZDB-MRPHLNO-170502-3
Name
MO3-cyp19a1b
Previous Names
None
Target
Sequence
5' - TTACCACATGCTCCATCATCACCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-cyp19a1b
No data available
Phenotype
Phenotype resulting from MO3-cyp19a1b
Phenotype Fish Figures
caudal fin morphology, abnormal y1Tg + MO3-cyp19a1b Fig. 4 from Alharthy et al., 2017
eye decreased size, abnormal y1Tg + MO3-cyp19a1b Fig. 3 from Alharthy et al., 2017
hatching decreased occurrence, abnormal y1Tg + MO3-cyp19a1b Fig. 2 from Alharthy et al., 2017
pericardium edematous, abnormal y1Tg + MO3-cyp19a1b Fig. 3 from Alharthy et al., 2017
swim bladder uninflated, abnormal y1Tg + MO3-cyp19a1b Fig. 3 from Alharthy et al., 2017
whole organism decreased length, abnormal y1Tg + MO3-cyp19a1b Fig. 3 from Alharthy et al., 2017
whole organism decreased life span, abnormal y1Tg + MO3-cyp19a1b Fig. 2 from Alharthy et al., 2017
whole organism estradiol decreased amount, abnormal y1Tg + MO3-cyp19a1b Fig. 5 from Alharthy et al., 2017
yolk edematous, abnormal y1Tg + MO3-cyp19a1b Fig. 3 from Alharthy et al., 2017
Phenotype of all Fish created by or utilizing MO3-cyp19a1b
Phenotype Fish Conditions Figures
pericardium edematous, abnormal y1Tg + MO3-cyp19a1b control Fig. 3 from Alharthy et al., 2017
whole organism decreased life span, abnormal y1Tg + MO3-cyp19a1b control Fig. 2 from Alharthy et al., 2017
pericardium edematous, ameliorated y1Tg + MO3-cyp19a1b chemical treatment by environment: 17beta-estradiol Fig. 3 from Alharthy et al., 2017
whole organism decreased length, abnormal y1Tg + MO3-cyp19a1b control Fig. 3 from Alharthy et al., 2017
yolk edematous, ameliorated y1Tg + MO3-cyp19a1b chemical treatment by environment: 17beta-estradiol Fig. 3 from Alharthy et al., 2017
eye decreased size, abnormal y1Tg + MO3-cyp19a1b control Fig. 3 from Alharthy et al., 2017
swim bladder uninflated, abnormal y1Tg + MO3-cyp19a1b chemical treatment by environment: 17beta-estradiol Fig. 3 from Alharthy et al., 2017
caudal fin morphology, abnormal y1Tg + MO3-cyp19a1b control Fig. 4 from Alharthy et al., 2017
yolk edematous, abnormal y1Tg + MO3-cyp19a1b control Fig. 3 from Alharthy et al., 2017
whole organism estradiol decreased amount, abnormal y1Tg + MO3-cyp19a1b control Fig. 5 from Alharthy et al., 2017
hatching occurrence, ameliorated y1Tg + MO3-cyp19a1b chemical treatment by environment: 17beta-estradiol Fig. 2 from Alharthy et al., 2017
hatching decreased occurrence, abnormal y1Tg + MO3-cyp19a1b control Fig. 2 from Alharthy et al., 2017
caudal fin morphology, ameliorated y1Tg + MO3-cyp19a1b chemical treatment by environment: 17beta-estradiol Fig. 4 from Alharthy et al., 2017
swim bladder uninflated, abnormal y1Tg + MO3-cyp19a1b control Fig. 3 from Alharthy et al., 2017
whole organism decreased length, ameliorated y1Tg + MO3-cyp19a1b chemical treatment by environment: 17beta-estradiol Fig. 3 from Alharthy et al., 2017
whole organism decreased life span, ameliorated y1Tg + MO3-cyp19a1b chemical treatment by environment: 17beta-estradiol Fig. 2 from Alharthy et al., 2017
eye decreased size, ameliorated y1Tg + MO3-cyp19a1b chemical treatment by environment: 17beta-estradiol Fig. 3 from Alharthy et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.