Morpholino

MO1-toe1

ID

ZDB-MRPHLNO-170426-1

Name

MO1-toe1

Previous Names

None

Target

Sequence

5' - CTGGGATTATCATTGAGGACGACAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-toe1

No data available

Phenotype

Phenotype resulting from MO1-toe1

Phenotype	Fish	Figures
cerebellum morphology, abnormal	AB/TU + MO1-toe1	Fig. 3 from Lardelli et al., 2017
cerebellum neuron decreased amount, abnormal	AB/TU + MO1-toe1	Fig. 3 from Lardelli et al., 2017
cerebellum neuron ab1-elavl labeling decreased amount, abnormal	AB/TU + MO1-toe1	Fig. 3 from Lardelli et al., 2017
eye decreased size, abnormal	AB/TU + MO1-toe1	Fig. 3 from Lardelli et al., 2017
head decreased size, abnormal	AB/TU + MO1-toe1	Fig. 3 from Lardelli et al., 2017
head morphology, abnormal	AB/TU + MO1-toe1	Fig. 3 from Lardelli et al., 2017
hindbrain morphology, abnormal	AB/TU + MO1-toe1	Fig. 3 from Lardelli et al., 2017
hindbrain neuron decreased amount, abnormal	AB/TU + MO1-toe1	Fig. 3 from Lardelli et al., 2017
hindbrain neuron ab1-elavl labeling decreased amount, abnormal	AB/TU + MO1-toe1	Fig. 3 from Lardelli et al., 2017
post-vent region curved, abnormal	AB/TU + MO1-toe1	Fig. 3 from Lardelli et al., 2017

Phenotype of all Fish created by or utilizing MO1-toe1

Phenotype	Fish	Conditions	Figures
hindbrain morphology, abnormal	AB/TU + MO1-toe1	standard conditions	Fig. 3 from Lardelli et al., 2017
cerebellum morphology, abnormal	AB/TU + MO1-toe1	standard conditions	Fig. 3 from Lardelli et al., 2017
post-vent region curved, abnormal	AB/TU + MO1-toe1	standard conditions	Fig. 3 from Lardelli et al., 2017
head decreased size, abnormal	AB/TU + MO1-toe1	standard conditions	Fig. 3 from Lardelli et al., 2017
hindbrain neuron ab1-elavl labeling decreased amount, abnormal	AB/TU + MO1-toe1	standard conditions	Fig. 3 from Lardelli et al., 2017
eye decreased size, abnormal	AB/TU + MO1-toe1	standard conditions	Fig. 3 from Lardelli et al., 2017
cerebellum neuron decreased amount, abnormal	AB/TU + MO1-toe1	standard conditions	Fig. 3 from Lardelli et al., 2017
head morphology, abnormal	AB/TU + MO1-toe1	standard conditions	Fig. 3 from Lardelli et al., 2017
cerebellum neuron ab1-elavl labeling decreased amount, abnormal	AB/TU + MO1-toe1	standard conditions	Fig. 3 from Lardelli et al., 2017
hindbrain neuron decreased amount, abnormal	AB/TU + MO1-toe1	standard conditions	Fig. 3 from Lardelli et al., 2017

Citations