Morpholino

MO1-rbm7

ID

ZDB-MRPHLNO-170127-5

Name

MO1-rbm7

Previous Names

None

Target

rbm7 (1)

Sequence

5' - ATGGCCCAGCCTAGTGGAAAAAGAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rbm7

Expressed Gene	Anatomy	Figures
atxn1a	whole organism	Fig. 6 from Giunta et al., 2016
atxn1b	whole organism	Fig. 6 from Giunta et al., 2016

Phenotype

Phenotype resulting from MO1-rbm7

Phenotype	Fish	Figures
axonogenesis disrupted, abnormal	rw0Tg + MO1-rbm7	Fig. 5 from Giunta et al., 2016
cerebellar Purkinje cell layer structural organization disrupted, abnormal	rw0Tg + MO1-rbm7	Fig. 5 from Giunta et al., 2016
cerebellum structure, abnormal	rw0Tg + MO1-rbm7	Fig. 5 from Giunta et al., 2016
cerebellum Purkinje cell distributed, abnormal	rw0Tg + MO1-rbm7	Fig. 5 from Giunta et al., 2016
hindbrain morphology, abnormal	rw0Tg + MO1-rbm7	Fig. 4 from Giunta et al., 2016
hindbrain morphogenesis disrupted, abnormal	rw0Tg + MO1-rbm7	Fig. 4 from Giunta et al., 2016
motor neuron axon branchiness, abnormal	rw0Tg + MO1-rbm7	Fig. 5 from Giunta et al., 2016
motor neuron axon truncated, abnormal	rw0Tg + MO1-rbm7	Fig. 5 from Giunta et al., 2016
motor nucleus of vagal nerve shortened, abnormal	rw0Tg + MO1-rbm7	Fig. 4 from Giunta et al., 2016

Phenotype of all Fish created by or utilizing MO1-rbm7

Phenotype	Fish	Conditions	Figures
axonogenesis disrupted, abnormal	rw0Tg + MO1-rbm7	standard conditions	Fig. 5 from Giunta et al., 2016
cerebellum structure, abnormal	rw0Tg + MO1-rbm7	standard conditions	Fig. 5 from Giunta et al., 2016
hindbrain morphogenesis disrupted, abnormal	rw0Tg + MO1-rbm7	standard conditions	Fig. 4 from Giunta et al., 2016
motor neuron axon branchiness, abnormal	rw0Tg + MO1-rbm7	standard conditions	Fig. 5 from Giunta et al., 2016
cerebellum Purkinje cell distributed, abnormal	rw0Tg + MO1-rbm7	standard conditions	Fig. 5 from Giunta et al., 2016
hindbrain morphology, abnormal	rw0Tg + MO1-rbm7	standard conditions	Fig. 4 from Giunta et al., 2016
motor neuron axon truncated, abnormal	rw0Tg + MO1-rbm7	standard conditions	Fig. 5 from Giunta et al., 2016
cerebellar Purkinje cell layer structural organization disrupted, abnormal	rw0Tg + MO1-rbm7	standard conditions	Fig. 5 from Giunta et al., 2016
motor nucleus of vagal nerve shortened, abnormal	rw0Tg + MO1-rbm7	standard conditions	Fig. 4 from Giunta et al., 2016
whole organism atxn1b expression increased amount, abnormal	slc24a5^{unspecified/unspecified} + MO1-rbm7	standard conditions	Fig. 6 from Giunta et al., 2016
whole organism deformed, abnormal	slc24a5^{unspecified/unspecified} + MO1-rbm7	standard conditions	Fig. 4 from Giunta et al., 2016
brain edematous, abnormal	slc24a5^{unspecified/unspecified} + MO1-rbm7	standard conditions	Fig. 4 from Giunta et al., 2016
head swollen, abnormal	slc24a5^{unspecified/unspecified} + MO1-rbm7	standard conditions	Fig. 4 from Giunta et al., 2016
eye decreased size, abnormal	slc24a5^{unspecified/unspecified} + MO1-rbm7	standard conditions	Fig. 4 from Giunta et al., 2016
whole organism decreased length, abnormal	slc24a5^{unspecified/unspecified} + MO1-rbm7	standard conditions	Fig. 4 from Giunta et al., 2016
thigmotaxis disrupted, abnormal	slc24a5^{unspecified/unspecified} + MO1-rbm7	standard conditions	Fig. text from Giunta et al., 2016
heart edematous, abnormal	slc24a5^{unspecified/unspecified} + MO1-rbm7	standard conditions	Fig. 4 from Giunta et al., 2016
embryo development delayed, abnormal	slc24a5^{unspecified/unspecified} + MO1-rbm7	standard conditions	Fig. 4 from Giunta et al., 2016
whole organism dead, abnormal	slc24a5^{unspecified/unspecified} + MO1-rbm7	standard conditions	Fig. 4 from Giunta et al., 2016
whole organism decreased life span, abnormal	slc24a5^{unspecified/unspecified} + MO1-rbm7	standard conditions	Fig. 4 from Giunta et al., 2016

Citations