Morpholino

MO6-pax2a

ID

ZDB-MRPHLNO-170127-23

Name

MO6-pax2a

Previous Names

None

Target

pax2a (1)

Sequence

5' - ATGTGCTTTTTCTTACCTTCCGAGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO6-pax2a

No data available

Phenotype

Phenotype resulting from MO6-pax2a

Phenotype	Fish	Figures
brain hydrocephalic, abnormal	WT + MO6-pax2a	Fig. S1 from Shim et al., 2016
heart edematous, abnormal	WT + MO6-pax2a	Fig. S1 from Shim et al., 2016
otolith malformed, abnormal	WT + MO6-pax2a	Fig. S1 from Shim et al., 2016
post-vent region curved, abnormal	WT + MO6-pax2a	Fig. S1 from Shim et al., 2016

Phenotype of all Fish created by or utilizing MO6-pax2a

Phenotype	Fish	Conditions	Figures
epidermis mmp9 expression increased amount, abnormal	AB + MO6-pax2a	hypotonic	Fig 7 from Hatzold et al., 2023
epidermis potentially cancerous lesions increased amount, abnormal	AB + MO6-pax2a	hypotonic	Fig 7 from Hatzold et al., 2023
otolith malformed, abnormal	WT + MO6-pax2a	standard conditions	Fig. S1 from Shim et al., 2016
heart edematous, abnormal	WT + MO6-pax2a	standard conditions	Fig. S1 from Shim et al., 2016
post-vent region curved, abnormal	WT + MO6-pax2a	standard conditions	Fig. S1 from Shim et al., 2016
brain hydrocephalic, abnormal	WT + MO6-pax2a	standard conditions	Fig. S1 from Shim et al., 2016
epidermis mmp9 expression increased amount, abnormal	AB + MO1-llgl2 + MO6-pax2a	hypotonic	Fig 7 from Hatzold et al., 2023
epidermis potentially cancerous lesions amount, ameliorated	AB + MO1-llgl2 + MO6-pax2a	hypotonic, chemical treatment by environment: sirolimus	Fig 7 from Hatzold et al., 2023
keratinocyte ab5-akt labeling spatial pattern, abnormal	AB + MO1-llgl2 + MO6-pax2a	hypotonic	Fig 7 from Hatzold et al., 2023
epidermis mmp9 expression amount, ameliorated	AB + MO1-llgl2 + MO6-pax2a	hypotonic, chemical treatment by environment: sirolimus	Fig 7 from Hatzold et al., 2023
keratinocyte ab5-akt labeling spatial pattern, ameliorated	AB + MO1-llgl2 + MO6-pax2a	hypotonic, chemical treatment by environment: LY294002	Fig 7 from Hatzold et al., 2023
epidermis mmp9 expression amount, ameliorated	AB + MO1-llgl2 + MO6-pax2a	hypotonic, chemical treatment by environment: LY294002	Fig 7 from Hatzold et al., 2023
keratinocyte ab5-akt labeling amount, ameliorated	AB + MO1-llgl2 + MO6-pax2a	hypotonic, chemical treatment by environment: LY294002	Fig 7 from Hatzold et al., 2023
epidermis potentially cancerous lesions increased amount, exacerbated	AB + MO1-llgl2 + MO6-pax2a	hypotonic	Fig 7 from Hatzold et al., 2023
epidermis potentially cancerous lesions amount, ameliorated	AB + MO1-llgl2 + MO6-pax2a	hypotonic, chemical treatment by environment: LY294002	Fig 7 from Hatzold et al., 2023
keratinocyte ab5-akt labeling increased amount, abnormal	AB + MO1-llgl2 + MO6-pax2a	hypotonic	Fig 7 from Hatzold et al., 2023
epidermis potentially cancerous lesions amount, ameliorated	AB + MO1-llgl2 + MO6-pax2a	hypotonic, chemical treatment by environment: wortmannin	Fig 7 from Hatzold et al., 2023

Citations