Morpholino

MO1-dagla

ID

ZDB-MRPHLNO-170123-1

Name

MO1-dagla

Previous Names

None

Target

dagla (1)

Sequence

5' - TGCCCGGCATCACTGCCCTGAAACA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dagla

No data available

Phenotype

Phenotype resulting from MO1-dagla

Phenotype	Fish	Figures
axonogenesis disrupted, abnormal	WT + MO1-dagla	Fig. 6 from Martella et al., 2016
cerebellum axon morphology, abnormal	WT + MO1-dagla	Fig. 6 from Martella et al., 2016
cranial nerve X disorganized, abnormal	WT + MO1-dagla	Fig. 6 from Martella et al., 2016
cranial nerve X misrouted, abnormal	WT + MO1-dagla	Fig. 6 from Martella et al., 2016
lipoprotein lipase activity disrupted, abnormal	WT + MO1-dagla	Fig. 5 from Martella et al., 2016
optic tectum axon decreased amount, abnormal	WT + MO1-dagla	Fig. 6 from Martella et al., 2016
optokinetic behavior process quality, abnormal	WT + MO1-dagla	Fig. 7 from Martella et al., 2016
retinal ganglion cell axon hypoplastic, abnormal	WT + MO1-dagla	Fig. 6 from Martella et al., 2016
swimming behavior process quality, abnormal	WT + MO1-dagla	Fig. 8 from Martella et al., 2016

Phenotype of all Fish created by or utilizing MO1-dagla

Phenotype	Fish	Conditions	Figures
lipoprotein lipase activity disrupted, abnormal	WT + MO1-dagla	standard conditions	Fig. 5 from Martella et al., 2016
axonogenesis disrupted, abnormal	WT + MO1-dagla	standard conditions	Fig. 6 from Martella et al., 2016
axonogenesis process quality, ameliorated	WT + MO1-dagla	chemical treatment by environment: 2-arachidonyl glyceryl ether	Fig. 6 from Martella et al., 2016
cranial nerve X misrouted, abnormal	WT + MO1-dagla	standard conditions	Fig. 6 from Martella et al., 2016
cranial nerve X disorganized, abnormal	WT + MO1-dagla	standard conditions	Fig. 6 from Martella et al., 2016
optic tectum axon amount, ameliorated	WT + MO1-dagla	chemical treatment by environment: 2-arachidonyl glyceryl ether	Fig. 6 from Martella et al., 2016
swimming behavior process quality, ameliorated	WT + MO1-dagla	chemical treatment by environment: 2-arachidonyl glyceryl ether	Fig. 8 from Martella et al., 2016
optokinetic behavior process quality, abnormal	WT + MO1-dagla	standard conditions	Fig. 7 from Martella et al., 2016
retinal ganglion cell axon hypoplastic, abnormal	WT + MO1-dagla	standard conditions	Fig. 6 from Martella et al., 2016
swimming behavior process quality, abnormal	WT + MO1-dagla	standard conditions	Fig. 8 from Martella et al., 2016
optic tectum axon decreased amount, abnormal	WT + MO1-dagla	standard conditions	Fig. 6 from Martella et al., 2016
cerebellum axon morphology, abnormal	WT + MO1-dagla	standard conditions	Fig. 6 from Martella et al., 2016
cerebellum axon morphology, ameliorated	WT + MO1-dagla	chemical treatment by environment: 2-arachidonyl glyceryl ether	Fig. 6 from Martella et al., 2016

Citations