Morpholino

MO6-mecom

ID
ZDB-MRPHLNO-161213-2
Name
MO6-mecom
Previous Names
None
Target
Sequence
5' - TGAAGGGTCTGAGTGACTTACATAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-mecom
No data available
Phenotype
Phenotype resulting from MO6-mecom
No data available
Phenotype of all Fish created by or utilizing MO6-mecom
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1,  Fig. 4 from Konantz et al., 2016
thymus T cell rag1 expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
ventral wall of dorsal aorta dll4 expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 6 from Konantz et al., 2016
ventral wall of dorsal aorta monocyte decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
nucleate erythrocyte hbae3 expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
neutrophil mpx expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 7 from Konantz et al., 2016
ventral wall of dorsal aorta notch1b expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 6,  Fig. 7 from Konantz et al., 2016
ventral wall of dorsal aorta itga2b expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
thymus T cell decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
ventral wall of dorsal aorta gata2a expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
ventral wall of dorsal aorta neutrophil decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1,  Fig. 4 from Konantz et al., 2016
ventral wall of dorsal aorta nucleate erythrocyte decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
monocyte lcp1 expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 1 from Konantz et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal TU + MO5-mecom + MO6-mecom standard conditions Fig. 7 from Konantz et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal nkuasrfp1aTg; ubs3Tg + MO5-mecom + MO6-mecom standard conditions Fig. 7 from Konantz et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal nkuasrfp1aTg; ubs3Tg + MO5-mecom + MO6-mecom standard conditions Fig. 7 from Konantz et al., 2016
ventral wall of dorsal aorta notch1b expression decreased amount, abnormal nkuasrfp1aTg; ubs3Tg + MO5-mecom + MO6-mecom standard conditions Fig. 7 from Konantz et al., 2016
dorsal aorta vascular endothelium notch1b expression decreased amount, abnormal slc45a2b4/b4 + MO5-mecom + MO6-mecom standard conditions Fig. 2 from Konantz et al., 2016
dorsal aorta vascular endothelium dll4 expression decreased amount, abnormal slc45a2b4/b4 + MO5-mecom + MO6-mecom standard conditions Fig. 2 from Konantz et al., 2016
hematopoietic multipotent progenitor cell runx1 expression amount, ameliorated nc2aTg + MO5-mecom + MO6-mecom heat shock Fig. 4 from Konantz et al., 2016
ventral wall of dorsal aorta dll4 expression amount, ameliorated nc2aTg + MO5-mecom + MO6-mecom heat shock Fig. 6 from Konantz et al., 2016
hematopoietic multipotent progenitor cell myb expression amount, ameliorated nc2aTg + MO5-mecom + MO6-mecom heat shock Fig. 4 from Konantz et al., 2016
ventral wall of dorsal aorta notch1b expression amount, ameliorated nc2aTg + MO5-mecom + MO6-mecom heat shock Fig. 6 from Konantz et al., 2016
hematopoietic multipotent progenitor cell runx1 expression amount, ameliorated kca3Tg; kca4Tg + MO5-mecom + MO6-mecom heat shock Fig. 4 from Konantz et al., 2016
hematopoietic multipotent progenitor cell myb expression amount, ameliorated kca3Tg; kca4Tg + MO5-mecom + MO6-mecom heat shock Fig. 4 from Konantz et al., 2016
hematopoietic multipotent progenitor cell runx1 expression amount, ameliorated kca3Tg; mu101Tg + MO5-mecom + MO6-mecom heat shock Fig. 4 from Konantz et al., 2016
hematopoietic multipotent progenitor cell myb expression amount, ameliorated kca3Tg; mu101Tg + MO5-mecom + MO6-mecom heat shock Fig. 4 from Konantz et al., 2016
endothelial to hematopoietic transition decreased occurrence, abnormal nkuasrfp1aTg; ubs3Tg; zf169Tg + MO5-mecom + MO6-mecom standard conditions Fig. 5 from Konantz et al., 2016
angioblastic mesenchymal cell myb expression decreased amount, abnormal ubs16Tg; zf169Tg + MO5-mecom + MO6-mecom standard conditions Fig. 3 from Konantz et al., 2016
angioblastic mesenchymal cell flt1 expression increased amount, abnormal ubs16Tg; zf169Tg + MO5-mecom + MO6-mecom standard conditions Fig. 3 from Konantz et al., 2016
angioblastic mesenchymal cell kdrl expression increased amount, abnormal ubs16Tg; zf169Tg + MO5-mecom + MO6-mecom standard conditions Fig. 3 from Konantz et al., 2016
angioblastic mesenchymal cell dab2 expression increased amount, abnormal ubs16Tg; zf169Tg + MO5-mecom + MO6-mecom standard conditions Fig. 3 from Konantz et al., 2016
angioblastic mesenchymal cell ptprc expression decreased amount, abnormal ubs16Tg; zf169Tg + MO5-mecom + MO6-mecom standard conditions Fig. 3 from Konantz et al., 2016
angioblastic mesenchymal cell runx1 expression decreased amount, abnormal ubs16Tg; zf169Tg + MO5-mecom + MO6-mecom standard conditions Fig. 3 from Konantz et al., 2016
endothelial to hematopoietic transition decreased occurrence, abnormal ubs16Tg; zf169Tg + MO5-mecom + MO6-mecom standard conditions Fig. 3 from Konantz et al., 2016
angioblastic mesenchymal cell itga2b expression decreased amount, abnormal ubs16Tg; zf169Tg + MO5-mecom + MO6-mecom standard conditions Fig. 3 from Konantz et al., 2016
angioblastic mesenchymal cell cdh5 expression increased amount, abnormal ubs16Tg; zf169Tg + MO5-mecom + MO6-mecom standard conditions Fig. 3 from Konantz et al., 2016
endothelial to hematopoietic transition occurrence, ameliorated kca3Tg; nkuasrfp1aTg; ubs3Tg; zf169Tg + MO5-mecom + MO6-mecom standard conditions Fig. 5 from Konantz et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.