Morpholino

MO2-tgfbr3

ID
ZDB-MRPHLNO-160902-3
Name
MO2-tgfbr3
Previous Names
None
Target
Sequence
5' - GAATAACAGCGCTTACCTGCAGAGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tgfbr3
Expressed Gene Anatomy Figures
tgfbr3 Fig. 5 with image from Kamaid et al., 2015
Phenotype
Phenotype resulting from MO2-tgfbr3
Phenotype Fish Figures
caudal fin curved, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with image from Kamaid et al., 2015
caudal vein plexus morphology, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with image,  Fig. 6 with image from Kamaid et al., 2015
caudal vein plexus sprouting angiogenesis process quality, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with image,  Fig. 6 with image from Kamaid et al., 2015
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Kamaid et al., 2015
dorsal longitudinal anastomotic vessel blood vessel development decreased occurrence, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Kamaid et al., 2015
intersegmental vessel decreased amount, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with image from Kamaid et al., 2015
intersegmental vessel decreased size, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Kamaid et al., 2015
intersegmental vessel sprouting angiogenesis process quality, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with image from Kamaid et al., 2015
lymphangioblast cord spatial pattern, abnormal y1Tg + MO2-tgfbr3 Fig. 2 with image from Molina-Villa et al., 2021
notochord tgfbr3 expression absent, abnormal y1Tg + MO2-tgfbr3 Fig. 5 with image from Kamaid et al., 2015
somite circular, abnormal y1Tg + MO2-tgfbr3 Fig. 7 with image from Kamaid et al., 2015
somite shape, abnormal y1Tg + MO2-tgfbr3 Fig. 7 with image from Kamaid et al., 2015
somite actin filament disorganized, abnormal y1Tg + MO2-tgfbr3 Fig. 7 with image from Kamaid et al., 2015
somite ventral region tgfbr3 expression absent, abnormal y1Tg + MO2-tgfbr3 Fig. 5 with image from Kamaid et al., 2015
somite border blurry, abnormal y1Tg + MO2-tgfbr3 Fig. 7 with image from Kamaid et al., 2015
whole organism tgfbr3 expression absent, abnormal WT + MO2-tgfbr3 Fig. 5 with image from Kamaid et al., 2015
whole organism decreased size, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with image from Kamaid et al., 2015
whole organism morphology, abnormal y1Tg + MO2-tgfbr3 Fig. 2 with image from Molina-Villa et al., 2021
whole organism shape, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with image from Kamaid et al., 2015
Phenotype of all Fish created by or utilizing MO2-tgfbr3
Phenotype Fish Conditions Figures
whole organism tgfbr3 expression absent, abnormal WT + MO2-tgfbr3 standard conditions Fig. 5 with image from Kamaid et al., 2015
somite ventral region tgfbr3 expression absent, abnormal y1Tg + MO2-tgfbr3 control Fig. 5 with image from Kamaid et al., 2015
somite circular, abnormal y1Tg + MO2-tgfbr3 control Fig. 7 with image from Kamaid et al., 2015
intersegmental vessel sprouting angiogenesis process quality, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image from Kamaid et al., 2015
dorsal longitudinal anastomotic vessel blood vessel development decreased occurrence, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Kamaid et al., 2015
whole organism morphology, abnormal y1Tg + MO2-tgfbr3 control Fig. 2 with image from Molina-Villa et al., 2021
intersegmental vessel decreased amount, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image from Kamaid et al., 2015
notochord tgfbr3 expression absent, abnormal y1Tg + MO2-tgfbr3 control Fig. 5 with image from Kamaid et al., 2015
lymphangioblast cord spatial pattern, abnormal y1Tg + MO2-tgfbr3 control Fig. 2 with image from Molina-Villa et al., 2021
caudal vein plexus morphology, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image,  Fig. 6 with image from Kamaid et al., 2015
somite actin filament disorganized, abnormal y1Tg + MO2-tgfbr3 control Fig. 7 with image from Kamaid et al., 2015
caudal vein plexus sprouting angiogenesis process quality, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image,  Fig. 6 with image from Kamaid et al., 2015
caudal fin curved, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image from Kamaid et al., 2015
whole organism shape, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image from Kamaid et al., 2015
whole organism decreased size, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image from Kamaid et al., 2015
intersegmental vessel decreased size, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Kamaid et al., 2015
somite shape, abnormal y1Tg + MO2-tgfbr3 control Fig. 7 with image from Kamaid et al., 2015
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Kamaid et al., 2015
somite border blurry, abnormal y1Tg + MO2-tgfbr3 control Fig. 7 with image from Kamaid et al., 2015
whole organism morphology, abnormal tgfbr3una202/una202; y1Tg + MO2-tgfbr3 control Fig. 2 with image from Molina-Villa et al., 2021
lymphangioblast cord spatial pattern, abnormal tgfbr3una202/una202; y1Tg + MO2-tgfbr3 control Fig. 2 with image from Molina-Villa et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.