Morpholino

MO2-hmox1a

ID
ZDB-MRPHLNO-160803-1
Name
MO2-hmox1a
Previous Names
None
Target
Sequence
5' - AGTCCATCTTTGTGCTGTAGATGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-hmox1a
Expressed Gene Anatomy Figures
hmox1a Fig. 2,  Fig. 3 from Tzaneva et al., 2016
Fig. 1,  Fig. 3 from Tzaneva et al., 2016
Phenotype
Phenotype resulting from MO2-hmox1a
Phenotype Fish Figures
cardiac ventricle increased volume, abnormal WT + MO2-hmox1a Fig. 5 from Tzaneva et al., 2016
heart hmox1a expression absent, abnormal WT + MO2-hmox1a Fig. 2 from Tzaneva et al., 2016
heart contraction increased rate, abnormal WT + MO2-hmox1a Fig. 4 from Tzaneva et al., 2016
neuroepithelial cell hmox1a expression decreased amount, abnormal WT + MO2-hmox1a Fig. 1 from Tzaneva et al., 2016
respiratory gaseous exchange by respiratory system increased frequency, abnormal WT + MO2-hmox1a Fig. 5 from Tzaneva et al., 2016
whole organism hmox1a expression decreased amount, abnormal WT + MO2-hmox1a Fig. 3 from Tzaneva et al., 2016
Fig. 3 from Tzaneva et al., 2016
Phenotype of all Fish created by or utilizing MO2-hmox1a
Phenotype Fish Conditions Figures
respiratory gaseous exchange by respiratory system increased frequency, abnormal WT + MO2-hmox1a control Fig. 5 from Tzaneva et al., 2016
neuroepithelial cell hmox1a expression decreased amount, abnormal WT + MO2-hmox1a standard conditions Fig. 1 from Tzaneva et al., 2016
cardiac ventricle increased volume, abnormal WT + MO2-hmox1a standard conditions Fig. 5 from Tzaneva et al., 2016
respiratory gaseous exchange by respiratory system frequency, ameliorated WT + MO2-hmox1a hypoxia, chemical treatment by environment: CORM 3 Fig. 5 from Tzaneva et al., 2016
heart contraction rate, ameliorated WT + MO2-hmox1a chemical treatment by environment: carbon monoxide Fig. 4 from Tzaneva et al., 2016
respiratory gaseous exchange by respiratory system frequency, ameliorated WT + MO2-hmox1a chemical treatment by environment: CORM 3 Fig. 5 from Tzaneva et al., 2016
whole organism hmox1a expression decreased amount, abnormal WT + MO2-hmox1a hypoxia Fig. 3 from Tzaneva et al., 2016
respiratory gaseous exchange by respiratory system decreased frequency, abnormal WT + MO2-hmox1a chemical treatment by environment: CORM 3, chemical treatment by environment: phenylhydrazine Fig. 5 from Tzaneva et al., 2016
whole organism hmox1a expression decreased amount, abnormal WT + MO2-hmox1a hypoxia Fig. 3 from Tzaneva et al., 2016
heart contraction rate, ameliorated WT + MO2-hmox1a hypoxia, chemical treatment by environment: carbon monoxide Fig. 4 from Tzaneva et al., 2016
whole organism hmox1a expression decreased amount, abnormal WT + MO2-hmox1a control Fig. 3 from Tzaneva et al., 2016
Fig. 3 from Tzaneva et al., 2016
heart contraction increased rate, abnormal WT + MO2-hmox1a hypoxia Fig. 4 from Tzaneva et al., 2016
heart hmox1a expression absent, abnormal WT + MO2-hmox1a standard conditions Fig. 2 from Tzaneva et al., 2016
response to hypoxia decreased process quality, abnormal WT + MO2-hmox1a hypoxia Fig. 3 from Tzaneva et al., 2016
heart contraction increased rate, abnormal WT + MO2-hmox1a standard conditions Fig. 4 from Tzaneva et al., 2016
heart contraction increased rate, abnormal WT + MO2-hmox1a chemical treatment by environment: (R)-adrenaline Fig. 4 from Tzaneva et al., 2016
blood circulation increased process quality, abnormal WT + MO2-hmox1a hypoxia Fig. 5 from Tzaneva et al., 2016
respiratory gaseous exchange by respiratory system increased frequency, abnormal WT + MO2-hmox1a hypoxia Fig. 5 from Tzaneva et al., 2016
whole organism heme oxygenase (decyclizing) activity decreased process quality, abnormal WT + MO2-hmox1a hypoxia Fig. 3 from Tzaneva et al., 2016
respiratory gaseous exchange by respiratory system increased frequency, abnormal WT + MO2-hmox1a chemical treatment by environment: phenylhydrazine Fig. 5 from Tzaneva et al., 2016
caudal vein plexus blood coagulation, fibrin clot formation increased frequency, ameliorated smarca5zko1049a/zko1049a + MO2-hmox1a standard conditions Figure 6 with image from Ding et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.