Morpholino

MO1-adamts9

ID

ZDB-MRPHLNO-160621-2

Name

MO1-adamts9

Previous Names

exon 2 (1)

Target

adamts9 (1)

Sequence

5' - GTATGCGTTTTCCTGCTTACCTGAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-adamts9

No data available

Phenotype

Phenotype resulting from MO1-adamts9

Phenotype	Fish	Figures
brain hydrocephalic, abnormal	AB + MO1-adamts9	Fig. 5 from Choi et al., 2019
endocrine pancreas EGFP expression decreased distribution, abnormal	nl1Tg + MO1-adamts9	Fig. S10 from O'Hare et al., 2016
endocrine pancreas decreased size, abnormal	nl1Tg + MO1-adamts9	Fig. S10 from O'Hare et al., 2016
endocrine pancreas development disrupted, abnormal	nl1Tg + MO1-adamts9	Fig. S10 from O'Hare et al., 2016
enteroendocrine cell differentiation disrupted, abnormal	nl1Tg + MO1-adamts9	Fig. S10 from O'Hare et al., 2016
pancreatic B cell decreased amount, abnormal	jh1Tg; jh2Tg + MO1-adamts9	Fig. 2 from O'Hare et al., 2016
pancreatic B cell decreased area, abnormal	jh1Tg; jh2Tg + MO1-adamts9	Fig. 1 from O'Hare et al., 2016
pronephros cystic, abnormal	AB + MO1-adamts9	Fig. 5 from Choi et al., 2019
whole organism curved ventral, abnormal	AB + MO1-adamts9	Fig. 5 from Choi et al., 2019

Phenotype of all Fish created by or utilizing MO1-adamts9

Phenotype	Fish	Conditions	Figures
pronephros cystic, abnormal	AB + MO1-adamts9	standard conditions	Fig. 5 from Choi et al., 2019
brain hydrocephalic, abnormal	AB + MO1-adamts9	standard conditions	Fig. 5 from Choi et al., 2019
whole organism curved ventral, abnormal	AB + MO1-adamts9	standard conditions	Fig. 5 from Choi et al., 2019
endocrine pancreas EGFP expression decreased distribution, abnormal	nl1Tg + MO1-adamts9	standard conditions	Fig. S10 from O'Hare et al., 2016
endocrine pancreas development disrupted, abnormal	nl1Tg + MO1-adamts9	standard conditions	Fig. S10 from O'Hare et al., 2016
endocrine pancreas decreased size, abnormal	nl1Tg + MO1-adamts9	standard conditions	Fig. S10 from O'Hare et al., 2016
enteroendocrine cell differentiation disrupted, abnormal	nl1Tg + MO1-adamts9	standard conditions	Fig. S10 from O'Hare et al., 2016
response to glucose decreased process quality, abnormal	jh1Tg; jh2Tg + MO1-adamts9	chemical treatment by environment: glucose	Fig. 4 from O'Hare et al., 2016
pancreatic B cell decreased amount, abnormal	jh1Tg; jh2Tg + MO1-adamts9	standard conditions	Fig. 2 from O'Hare et al., 2016
pancreatic B cell decreased area, abnormal	jh1Tg; jh2Tg + MO1-adamts9	standard conditions	Fig. 1 from O'Hare et al., 2016
pancreatic B cell decreased amount, abnormal	jh1Tg; jh2Tg + MO1-adamts9	chemical treatment by environment: glucose	Fig. 4 from O'Hare et al., 2016
pancreatic B cell regeneration decreased rate, abnormal	jh4Tg + MO1-adamts9	chemical ablation: pancreatic B cell, chemical treatment by environment: metronidazole	Fig. 5 from O'Hare et al., 2016

Citations