Morpholino

MO2-col15a1b

ID

ZDB-MRPHLNO-160517-1

Name

MO2-col15a1b

Previous Names

None

Target

col15a1b (1)

Sequence

5' - AAAGTCCAAGCATGAGATTAGTGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-col15a1b

Expressed Gene	Anatomy	Figures
col15a1b	(not) myotome extracellular matrix (not) vertical myoseptum	Fig. 6 from Guillon et al., 2016
smyhc1	myotome slow muscle cell	Fig. 10 from Guillon et al., 2016

Phenotype

Phenotype resulting from MO2-col15a1b

Phenotype	Fish	Figures
fast muscle cell has fewer parts of type fast muscle cell skeletal muscle myofibril, abnormal	AB/TU + MO2-col15a1b	Fig. 10 from Guillon et al., 2016
myotome atrophied, abnormal	AB/TU + MO2-col15a1b	Fig. 10 from Guillon et al., 2016
myotome extracellular matrix col15a1b expression absent, abnormal	AB/TU + MO2-col15a1b	Fig. 6 from Guillon et al., 2016
myotome fast muscle cell decreased area, abnormal	AB/TU + MO2-col15a1b	Fig. 10 from Guillon et al., 2016
myotome skeletal muscle tissue development decreased process quality, abnormal	AB/TU + MO2-col15a1b	Fig. 10 from Guillon et al., 2016
myotome slow muscle cell shape, abnormal	AB/TU + MO2-col15a1b	Fig. 10 from Guillon et al., 2016
thigmotaxis decreased process quality, abnormal	AB/TU + MO2-col15a1b	Fig. 11 from Guillon et al., 2016
vertical myoseptum col15a1b expression absent, abnormal	AB/TU + MO2-col15a1b	Fig. 6 from Guillon et al., 2016

Phenotype of all Fish created by or utilizing MO2-col15a1b

Phenotype	Fish	Conditions	Figures
thigmotaxis decreased process quality, abnormal	AB/TU + MO2-col15a1b	standard conditions	Fig. 11 from Guillon et al., 2016
myotome fast muscle cell decreased area, abnormal	AB/TU + MO2-col15a1b	standard conditions	Fig. 10 from Guillon et al., 2016
myotome extracellular matrix col15a1b expression absent, abnormal	AB/TU + MO2-col15a1b	control	Fig. 6 from Guillon et al., 2016
vertical myoseptum col15a1b expression absent, abnormal	AB/TU + MO2-col15a1b	control	Fig. 6 from Guillon et al., 2016
fast muscle cell has fewer parts of type fast muscle cell skeletal muscle myofibril, abnormal	AB/TU + MO2-col15a1b	standard conditions	Fig. 10 from Guillon et al., 2016
myotome atrophied, abnormal	AB/TU + MO2-col15a1b	standard conditions	Fig. 10 from Guillon et al., 2016
myotome slow muscle cell shape, abnormal	AB/TU + MO2-col15a1b	standard conditions	Fig. 10 from Guillon et al., 2016
myotome skeletal muscle tissue development decreased process quality, abnormal	AB/TU + MO2-col15a1b	standard conditions	Fig. 10 from Guillon et al., 2016
primary motor neuron motor neuron axon guidance decreased process quality, abnormal	AB/TU + MO2-col15a1b + MO3-col15a1b	standard conditions	Fig. 8 from Guillon et al., 2016
myotome skeletal muscle cell differentiation process quality, abnormal	AB/TU + MO2-col15a1b + MO3-col15a1b	standard conditions	Fig. 7 from Guillon et al., 2016
myotome has extra parts of type muscle pioneer, abnormal	AB/TU + MO2-col15a1b + MO3-col15a1b	standard conditions	Fig. 7 from Guillon et al., 2016
CaP motoneuron axon truncated, abnormal	AB/TU + MO2-col15a1b + MO3-col15a1b	standard conditions	Fig. 8 from Guillon et al., 2016
secondary motor neuron motor neuron axon guidance decreased process quality, abnormal	AB/TU + MO2-col15a1b + MO3-col15a1b	standard conditions	Fig. 9 from Guillon et al., 2016
muscle pioneer en2a expression increased distribution, abnormal	AB/TU + MO2-col15a1b + MO3-col15a1b	standard conditions	Fig. 7 from Guillon et al., 2016

Citations