Morpholino

MO4-has2

ID
ZDB-MRPHLNO-160413-11
Name
MO4-has2
Previous Names
None
Target
Sequence
5' - GCTGACCGCTTTATCACATCTCATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-has2
No data available
Phenotype
Phenotype resulting from MO4-has2
Phenotype of all Fish created by or utilizing MO4-has2
Phenotype Fish Conditions Figures
regenerating fin decreased length, abnormal AB/C32 + MO4-has2 amputation: caudal fin Fig. 3 with imageFig. 4 from Govindan et al., 2016
regenerating fin cell population proliferation decreased occurrence, abnormal AB/C32 + MO4-has2 amputation: caudal fin Fig. 3 with imageFig. 4 from Govindan et al., 2016
regenerating fin lepidotrichium segment decreased length, abnormal AB/C32 + MO4-has2 amputation: caudal fin Fig. 3 with imageFig. 4 from Govindan et al., 2016
vein protruding out of caudal fin subintestinal vein, abnormal sd2Tg; y1Tg + MO4-has2 standard conditions Fig. 5 with image from Hsieh et al., 2018
vein protruding out of caudal fin intersegmental vein, abnormal sd2Tg; y1Tg + MO4-has2 standard conditions Fig. 5 with image from Hsieh et al., 2018
caudal fin intersegmental vein morphology, abnormal sd2Tg; y1Tg + MO4-has2 standard conditions Fig. 5 with image from Hsieh et al., 2018
caudal fin intersegmental vein dilated, abnormal sd2Tg; y1Tg + MO4-has2 standard conditions Fig. 5 with image from Hsieh et al., 2018
caudal vein plexus dilated, abnormal sd2Tg; y1Tg + MO4-has2 standard conditions Fig. 4 with image from Hsieh et al., 2018
caudal fin vein tangled, abnormal sd2Tg; y1Tg + MO4-has2 standard conditions Fig. 4 with image from Hsieh et al., 2018
caudal fin morphology, abnormal sd2Tg; y1Tg + MO4-has2 standard conditions Fig. 4 with image from Hsieh et al., 2018
caudal fin subintestinal vein dilated, abnormal sd2Tg; y1Tg + MO4-has2 standard conditions Fig. 5 with image from Hsieh et al., 2018
caudal fin subintestinal vein morphology, abnormal sd2Tg; y1Tg + MO4-has2 standard conditions Fig. 5 with image from Hsieh et al., 2018
regenerating fin cell population proliferation decreased occurrence, abnormal AB/C32 + MO1-has1 + MO4-has2 amputation: caudal fin Fig. 4 from Govindan et al., 2016
regenerating fin lepidotrichium segment decreased length, abnormal AB/C32 + MO1-has1 + MO4-has2 amputation: caudal fin Fig. 4 from Govindan et al., 2016
regenerating fin decreased length, abnormal AB/C32 + MO1-has1 + MO4-has2 amputation: caudal fin Fig. 4 from Govindan et al., 2016
Citations