Morpholino

MO2-fosab

ID
ZDB-MRPHLNO-160225-7
Name
MO2-fosab
Previous Names
None
Target
Sequence
5' - GCGTTAAGGCTGGTAAACATCATCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-fosab
No data available
Phenotype
Phenotype resulting from MO2-fosab
Phenotype Fish Figures
basibranchial decreased amount, abnormal WT + MO2-fosab FIGURE 4 with image from Maili et al., 2023
branchiostegal ray ossification process quality, abnormal WT + MO2-fosab FIGURE 4 with image from Maili et al., 2023
ceratobranchial 5 bone bone mineralization decreased process quality, abnormal WT + MO2-fosab FIGURE 4 with image from Maili et al., 2023
ceratobranchial 5 bone ossification process quality, abnormal WT + MO2-fosab FIGURE 4 with image from Maili et al., 2023
ceratobranchial 5 tooth decreased amount, abnormal WT + MO2-fosab FIGURE 4 with image from Maili et al., 2023
cleithrum decreased size, abnormal WT + MO2-fosab FIGURE 4 with image from Maili et al., 2023
ethmoid cartilage decreased size, abnormal WT + MO2-fosab FIGURE 4 with image from Maili et al., 2023
extension morphology, abnormal WT + MO2-fosab FIGURE 2 with image from Maili et al., 2023
eye decreased size, abnormal WT + MO2-fosab FIGURE 2 with image from Maili et al., 2023
head decreased size, abnormal WT + MO2-fosab FIGURE 2 with image from Maili et al., 2023
head morphology, abnormal WT + MO2-fosab FIGURE 2 with image from Maili et al., 2023
head cell death increased occurrence, abnormal WT + MO2-fosab FIGURE 6 with image from Maili et al., 2023
Meckel's cartilage decreased size, abnormal WT + MO2-fosab FIGURE 4 with image from Maili et al., 2023
mouth shape, abnormal WT + MO2-fosab FIGURE 2 with image from Maili et al., 2023
neural crest cell migration disrupted, abnormal ba2Tg + MO2-fosab FIGURE 6 with image from Maili et al., 2023
neurocranial trabecula decreased size, abnormal WT + MO2-fosab FIGURE 4 with image from Maili et al., 2023
neuromast fused with neuromast, abnormal WT + MO2-fosab FIGURE 2 with image from Maili et al., 2023
neuromast mislocalised, abnormal WT + MO2-fosab FIGURE 2 with image from Maili et al., 2023
olfactory pit decreased size, abnormal gz7Tg + MO2-fosab FIGURE 5 with image from Maili et al., 2023
opercle decreased size, abnormal WT + MO2-fosab FIGURE 4 with image from Maili et al., 2023
oral cavity decreased size, abnormal gz7Tg + MO2-fosab FIGURE 5 with image from Maili et al., 2023
oral epithelium epithelial cell decreased size, abnormal gz7Tg + MO2-fosab FIGURE 5 with image from Maili et al., 2023
oral epithelium epithelial cell spatial pattern, abnormal gz7Tg + MO2-fosab FIGURE 5 with image from Maili et al., 2023
otolith fused with otolith, abnormal WT + MO2-fosab FIGURE 4 with image from Maili et al., 2023
palatoquadrate cartilage decreased size, abnormal WT + MO2-fosab FIGURE 4 with image from Maili et al., 2023
parachordal cartilage decreased size, abnormal WT + MO2-fosab FIGURE 4 with image from Maili et al., 2023
parasphenoid ossification process quality, abnormal WT + MO2-fosab FIGURE 4 with image from Maili et al., 2023
pericardium edematous, abnormal WT + MO2-fosab FIGURE 2 with image from Maili et al., 2023
pharyngeal arch 1 fused with pharyngeal arch 2, abnormal ba2Tg + MO2-fosab FIGURE S10 from Maili et al., 2023
pharyngeal arch 1 morphology, abnormal ba2Tg + MO2-fosab FIGURE S10 from Maili et al., 2023
pharyngeal arch 2 morphology, abnormal ba2Tg + MO2-fosab FIGURE S10 from Maili et al., 2023
pharyngeal arch 3-7 shape, abnormal ba2Tg + MO2-fosab FIGURE S10 from Maili et al., 2023
tooth 3V absent, abnormal WT + MO2-fosab FIGURE 4 with image from Maili et al., 2023
tooth 4V decreased size, abnormal WT + MO2-fosab FIGURE 4 with image from Maili et al., 2023
tooth 4V morphology, abnormal WT + MO2-fosab FIGURE 4 with image from Maili et al., 2023
tooth 5V absent, abnormal WT + MO2-fosab FIGURE 4 with image from Maili et al., 2023
ventral mandibular arch morphology, abnormal WT + MO2-fosab FIGURE 2 with image from Maili et al., 2023
whole organism anterior-posterior axis increased curvature, abnormal WT + MO2-fosab FIGURE 2 with image from Maili et al., 2023
Phenotype of all Fish created by or utilizing MO2-fosab
Phenotype Fish Conditions Figures
regenerating tissue cardiac muscle cell proliferation decreased occurrence, abnormal EKW + MO2-fosab resection: cardiac ventricle Fig. 7 from Beauchemin et al., 2015
otolith fused with otolith, abnormal WT + MO2-fosab standard conditions FIGURE 4 with image from Maili et al., 2023
opercle decreased size, abnormal WT + MO2-fosab standard conditions FIGURE 4 with image from Maili et al., 2023
mouth shape, abnormal WT + MO2-fosab standard conditions FIGURE 2 with image from Maili et al., 2023
ceratobranchial 5 bone ossification process quality, abnormal WT + MO2-fosab standard conditions FIGURE 4 with image from Maili et al., 2023
neuromast fused with neuromast, abnormal WT + MO2-fosab standard conditions FIGURE 2 with image from Maili et al., 2023
tooth 4V morphology, abnormal WT + MO2-fosab standard conditions FIGURE 4 with image from Maili et al., 2023
whole organism anterior-posterior axis increased curvature, abnormal WT + MO2-fosab standard conditions FIGURE 2 with image from Maili et al., 2023
branchiostegal ray ossification process quality, abnormal WT + MO2-fosab standard conditions FIGURE 4 with image from Maili et al., 2023
tooth 5V absent, abnormal WT + MO2-fosab standard conditions FIGURE 4 with image from Maili et al., 2023
tooth 3V absent, abnormal WT + MO2-fosab standard conditions FIGURE 4 with image from Maili et al., 2023
parasphenoid ossification process quality, abnormal WT + MO2-fosab standard conditions FIGURE 4 with image from Maili et al., 2023
tooth 4V decreased size, abnormal WT + MO2-fosab standard conditions FIGURE 4 with image from Maili et al., 2023
ventral mandibular arch morphology, abnormal WT + MO2-fosab standard conditions FIGURE 2 with image from Maili et al., 2023
head cell death increased occurrence, abnormal WT + MO2-fosab standard conditions FIGURE 6 with image from Maili et al., 2023
head morphology, abnormal WT + MO2-fosab standard conditions FIGURE 2 with image from Maili et al., 2023
palatoquadrate cartilage decreased size, abnormal WT + MO2-fosab standard conditions FIGURE 4 with image from Maili et al., 2023
ethmoid cartilage decreased size, abnormal WT + MO2-fosab standard conditions FIGURE 4 with image from Maili et al., 2023
head decreased size, abnormal WT + MO2-fosab standard conditions FIGURE 2 with image from Maili et al., 2023
ceratobranchial 5 tooth decreased amount, abnormal WT + MO2-fosab standard conditions FIGURE 4 with image from Maili et al., 2023
ceratobranchial 5 bone bone mineralization decreased process quality, abnormal WT + MO2-fosab standard conditions FIGURE 4 with image from Maili et al., 2023
pericardium edematous, abnormal WT + MO2-fosab standard conditions FIGURE 2 with image from Maili et al., 2023
extension morphology, abnormal WT + MO2-fosab standard conditions FIGURE 2 with image from Maili et al., 2023
cleithrum decreased size, abnormal WT + MO2-fosab standard conditions FIGURE 4 with image from Maili et al., 2023
eye decreased size, abnormal WT + MO2-fosab standard conditions FIGURE 2 with image from Maili et al., 2023
parachordal cartilage decreased size, abnormal WT + MO2-fosab standard conditions FIGURE 4 with image from Maili et al., 2023
neuromast mislocalised, abnormal WT + MO2-fosab standard conditions FIGURE 2 with image from Maili et al., 2023
neurocranial trabecula decreased size, abnormal WT + MO2-fosab standard conditions FIGURE 4 with image from Maili et al., 2023
basibranchial decreased amount, abnormal WT + MO2-fosab standard conditions FIGURE 4 with image from Maili et al., 2023
Meckel's cartilage decreased size, abnormal WT + MO2-fosab standard conditions FIGURE 4 with image from Maili et al., 2023
pharyngeal arch 2 morphology, abnormal ba2Tg + MO2-fosab standard conditions FIGURE S10 from Maili et al., 2023
pharyngeal arch 1 fused with pharyngeal arch 2, abnormal ba2Tg + MO2-fosab standard conditions FIGURE S10 from Maili et al., 2023
neural crest cell migration disrupted, abnormal ba2Tg + MO2-fosab standard conditions FIGURE 6 with image from Maili et al., 2023
pharyngeal arch 3-7 shape, abnormal ba2Tg + MO2-fosab standard conditions FIGURE S10 from Maili et al., 2023
pharyngeal arch 1 morphology, abnormal ba2Tg + MO2-fosab standard conditions FIGURE S10 from Maili et al., 2023
olfactory pit decreased size, abnormal gz7Tg + MO2-fosab standard conditions FIGURE 5 with image from Maili et al., 2023
oral epithelium epithelial cell spatial pattern, abnormal gz7Tg + MO2-fosab standard conditions FIGURE 5 with image from Maili et al., 2023
oral cavity decreased size, abnormal gz7Tg + MO2-fosab standard conditions FIGURE 5 with image from Maili et al., 2023
oral epithelium epithelial cell decreased size, abnormal gz7Tg + MO2-fosab standard conditions FIGURE 5 with image from Maili et al., 2023
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.