Morpholino

MO1-iqcg

ID
ZDB-MRPHLNO-160211-6
Name
MO1-iqcg
Previous Names
None
Target
Sequence
5' - TCCTCCACGGACATCATACTGCTAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-iqcg
Expressed Gene Anatomy Figures
gata1a Fig. S1 from Chen et al., 2014
hbae1.1 Fig. S1 from Chen et al., 2014
myb Fig. 1 from Chen et al., 2014
runx1 Fig. 1 from Chen et al., 2014
spi1b Fig. S1 from Chen et al., 2014
tal1 Fig. S1 from Chen et al., 2014
Phenotype
Phenotype resulting from MO1-iqcg
Phenotype Fish Figures
blood island decreased size, abnormal WT + MO1-iqcg Fig. 1 from Chen et al., 2014
blood island disorganized, abnormal WT + MO1-iqcg Fig. 1 from Chen et al., 2014
caudal artery decreased distance caudal vein, abnormal WT + MO1-iqcg Fig. 1 from Chen et al., 2014
common myeloid progenitor myb expression decreased amount, abnormal WT + MO1-iqcg Fig. 1 from Chen et al., 2014
definitive hemopoiesis disrupted, abnormal WT + MO1-iqcg Fig. 1 from Chen et al., 2014
erythrocyte differentiation disrupted, abnormal WT + MO1-iqcg Fig. 1 from Chen et al., 2014
hematopoietic stem cell myb expression decreased amount, abnormal WT + MO1-iqcg Fig. 1 from Chen et al., 2014
hematopoietic stem cell decreased amount, abnormal WT + MO1-iqcg Fig. 1 from Chen et al., 2014
kidney myb expression decreased amount, abnormal WT + MO1-iqcg Fig. 1 from Chen et al., 2014
lymphocyte decreased amount, abnormal WT + MO1-iqcg Fig. 1 from Chen et al., 2014
monocyte decreased amount, abnormal WT + MO1-iqcg Fig. 1 from Chen et al., 2014
neutrophil decreased amount, abnormal WT + MO1-iqcg Fig. 1 from Chen et al., 2014
nucleate erythrocyte decreased amount, abnormal WT + MO1-iqcg Fig. 1 from Chen et al., 2014
thymus myb expression decreased amount, abnormal WT + MO1-iqcg Fig. 1 from Chen et al., 2014
ventral wall of dorsal aorta myb expression decreased amount, abnormal WT + MO1-iqcg Fig. 1 from Chen et al., 2014
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal WT + MO1-iqcg Fig. 1 from Chen et al., 2014
Phenotype of all Fish created by or utilizing MO1-iqcg
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta myb expression decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
hematopoietic stem cell myb expression decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
thymus myb expression decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
hematopoietic stem cell decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
nucleate erythrocyte decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
kidney myb expression decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
blood island disorganized, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
definitive hemopoiesis disrupted, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
monocyte decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
lymphocyte decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
blood island decreased size, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
erythrocyte differentiation disrupted, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
caudal artery decreased distance caudal vein, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
common myeloid progenitor myb expression decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
neutrophil decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
definitive hemopoiesis disrupted, abnormal WT + MO1-hsp70l + MO1-iqcg standard conditions Fig. S5 from Chen et al., 2014
common myeloid progenitor EGFP expression decreased amount, abnormal zf169Tg + MO1-iqcg standard conditions Fig. 1,  Fig. S1 from Chen et al., 2014
hematopoietic stem cell EGFP expression decreased amount, abnormal zf169Tg + MO1-iqcg standard conditions Fig. 1,  Fig. S1 from Chen et al., 2014
definitive hemopoiesis disrupted, abnormal zf169Tg + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
blood island cell population proliferation disrupted, abnormal zf169Tg + MO1-iqcg standard conditions Fig. 3 from Chen et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.