Morpholino

MO3-ccm2l

ID

ZDB-MRPHLNO-160205-1

Name

MO3-ccm2l

Previous Names

ex4SA (1)

Target

ccm2l (1)

Sequence

5' - AGCTTCTACAGGCATACAGAAATGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-ccm2l

No data available

Phenotype

Phenotype resulting from MO3-ccm2l

Phenotype	Fish	Figures
atrium increased size, abnormal	la116Tg + MO3-ccm2l	Fig. 3 from Cullere et al., 2015
cardiac ventricle increased size, abnormal	la116Tg + MO3-ccm2l	Fig. 3 from Cullere et al., 2015
heart contraction decreased rate, abnormal	la116Tg + MO3-ccm2l	Fig. 3 from Cullere et al., 2015
pericardial cavity increased size, abnormal	la116Tg + MO3-ccm2l	Fig. 3 from Cullere et al., 2015

Phenotype of all Fish created by or utilizing MO3-ccm2l

Phenotype	Fish	Conditions	Figures
cardiac ventricle increased size, abnormal	la116Tg + MO3-ccm2l	standard conditions	Fig. 3 from Cullere et al., 2015
atrium increased size, abnormal	la116Tg + MO3-ccm2l	standard conditions	Fig. 3 from Cullere et al., 2015
heart contraction decreased rate, abnormal	la116Tg + MO3-ccm2l	standard conditions	Fig. 3 from Cullere et al., 2015
pericardial cavity increased size, abnormal	la116Tg + MO3-ccm2l	standard conditions	Fig. 3 from Cullere et al., 2015
heart increased size, abnormal	ccm2^m201/+ + MO3-ccm2l	standard conditions	Fig. 3 from Cullere et al., 2015
whole organism dead, abnormal	ccm2^m201/+ + MO3-ccm2l	standard conditions	Fig. 3 from Cullere et al., 2015
heart non-functional, abnormal	ccm2^m201/+ + MO3-ccm2l	standard conditions	Fig. 3 from Cullere et al., 2015
whole organism anterior-posterior axis deformed, abnormal	ccm2^m201/+ + MO3-ccm2l	standard conditions	Fig. 3 from Cullere et al., 2015
heart increased size, abnormal	krit1^m775/+ + MO3-ccm2l	standard conditions	Fig. 3 from Cullere et al., 2015
whole organism dead, abnormal	krit1^m775/+ + MO3-ccm2l	standard conditions	Fig. 3 from Cullere et al., 2015
heart non-functional, abnormal	krit1^m775/+ + MO3-ccm2l	standard conditions	Fig. 3 from Cullere et al., 2015
whole organism anterior-posterior axis deformed, abnormal	krit1^m775/+ + MO3-ccm2l	standard conditions	Fig. 3 from Cullere et al., 2015
whole organism anterior-posterior axis deformed, ameliorated	AB/TU + MO1-map3k3 + MO3-ccm2l	standard conditions	Fig. 3 from Cullere et al., 2015
heart increased size, ameliorated	AB/TU + MO1-map3k3 + MO3-ccm2l	standard conditions	Fig. 3 from Cullere et al., 2015
whole organism anterior-posterior axis deformed, ameliorated	ccm2^m201/+ + MO1-map3k3 + MO3-ccm2l	standard conditions	Fig. 3 from Cullere et al., 2015
heart increased size, ameliorated	ccm2^m201/+ + MO1-map3k3 + MO3-ccm2l	standard conditions	Fig. 3 from Cullere et al., 2015

Citations