Morpholino

MO1-panx3

ID
ZDB-MRPHLNO-160127-3
Name
MO1-panx3
Previous Names
None
Target
Sequence
5' - GCGTTTGGCTCTGAAGAGATAAAAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-panx3
No data available
Phenotype
Phenotype resulting from MO1-panx3
Phenotype Fish Figures
branchiostegal ray intramembranous ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 4 from Oh et al., 2015
ceratobranchial 5 bone perichondral ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 4 from Oh et al., 2015
ceratohyal bone perichondral ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 4 from Oh et al., 2015
ceratohyal cartilage bent, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 4 from Oh et al., 2015
cleithrum col10a1a expression decreased distribution, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 8 from Oh et al., 2015
cleithrum malformed, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 4 from Oh et al., 2015
cranial skeletal system development disrupted, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 4 from Oh et al., 2015
hyomandibula perichondral ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 4 from Oh et al., 2015
intramembranous ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 4 from Oh et al., 2015
Meckel's cartilage bent, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 4 from Oh et al., 2015
mouth open, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 4 from Oh et al., 2015
opercle col10a1a expression decreased distribution, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 8 from Oh et al., 2015
opercle intramembranous ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 4 from Oh et al., 2015
osteoblast col10a1a expression absent, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 8 from Oh et al., 2015
osteoblast col10a1a expression decreased amount, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 8 from Oh et al., 2015
osteoblast col10a1a expression decreased distribution, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 8 from Oh et al., 2015
osteoblast differentiation delayed, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 8 from Oh et al., 2015
parasphenoid col10a1a expression decreased distribution, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 8 from Oh et al., 2015
parasphenoid intramembranous ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 4 from Oh et al., 2015
perichondral ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 4 from Oh et al., 2015
ventral mandibular arch decreased size, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 4 from Oh et al., 2015
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-panx3 + MO4-tp53 Fig. 4 from Oh et al., 2015
Phenotype of all Fish created by or utilizing MO1-panx3
Phenotype Fish Conditions Figures
intramembranous ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
parasphenoid intramembranous ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
ceratohyal bone perichondral ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
parasphenoid col10a1a expression decreased distribution, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
mouth open, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
Meckel's cartilage bent, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
cleithrum malformed, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
ceratohyal cartilage bent, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
opercle intramembranous ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
ceratobranchial 5 bone perichondral ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
osteoblast col10a1a expression absent, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
ventral mandibular arch decreased size, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
opercle col10a1a expression decreased distribution, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
cleithrum col10a1a expression decreased distribution, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
hyomandibula perichondral ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
osteoblast col10a1a expression decreased distribution, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
branchiostegal ray intramembranous ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
cranial skeletal system development disrupted, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
perichondral ossification decreased process quality, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 4 from Oh et al., 2015
osteoblast col10a1a expression decreased amount, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
osteoblast differentiation delayed, abnormal WT + MO1-panx3 + MO4-tp53 standard conditions Fig. 8 from Oh et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.