Morpholino

MO1-lnx2a

ID
ZDB-MRPHLNO-160119-3
Name
MO1-lnx2a
Previous Names
None
Target
Sequence
5' - TTGAGAACTTTACCTGTGTTTGAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lnx2a
No data available
Phenotype
Phenotype resulting from MO1-lnx2a
Phenotype Fish Figures
anterior pancreatic bud EGFP expression decreased distribution, abnormal jh1Tg + MO1-lnx2a Fig. 7 with imageFig. S2 with image from Won et al., 2015
anterior pancreatic bud ptf1a expression decreased distribution, abnormal AB + MO1-lnx2a Fig. S2 with imageFig. S7 with image from Won et al., 2015
anterior pancreatic bud mnx2a expression decreased distribution, abnormal AB + MO1-lnx2a Fig. S2 with imageFig. S7 with image from Won et al., 2015
anterior pancreatic bud cell population proliferation decreased process quality, abnormal jh1Tg + MO1-lnx2a Fig. 7 with image from Won et al., 2015
exocrine pancreas prss1 expression decreased amount, abnormal AB + MO1-lnx2a Fig. 2 with imageFig. 5 with image from Won et al., 2015
exocrine pancreas ptf1a expression decreased amount, abnormal AB + MO1-lnx2a Fig. 2 with imageFig. 5 with image from Won et al., 2015
exocrine pancreas ptf1a expression decreased distribution, abnormal AB + MO1-lnx2a Fig. 2 with imageFig. 5 with image from Won et al., 2015
exocrine pancreas prss1 expression decreased distribution, abnormal AB + MO1-lnx2a Fig. 2 with imageFig. 5 with image from Won et al., 2015
exocrine pancreas development decreased process quality, abnormal AB + MO1-lnx2a Fig. S5 with imageFig. S7 with image from Won et al., 2015
exocrine pancreas development disrupted, abnormal AB + MO1-lnx2a Fig. 2 with imageFig. 5 with image from Won et al., 2015
pancreas mCherry expression decreased distribution, abnormal s939Tg; s940Tg + MO1-lnx2a Fig. 6 with image from Won et al., 2015
pancreas Venus expression decreased distribution, abnormal s939Tg; s940Tg + MO1-lnx2a Fig. 6 with image from Won et al., 2015
pancreas numb expression increased distribution, abnormal s939Tg; s940Tg + MO1-lnx2a Fig. 6 with image from Won et al., 2015
pancreatic bud numb expression increased distribution, abnormal jh1Tg + MO1-lnx2a Fig. 7 with image from Won et al., 2015
Phenotype of all Fish created by or utilizing MO1-lnx2a
Phenotype Fish Conditions Figures
exocrine pancreas ptf1a expression decreased amount, abnormal AB + MO1-lnx2a control Fig. 2 with imageFig. 5 with image from Won et al., 2015
anterior pancreatic bud ptf1a expression decreased distribution, abnormal AB + MO1-lnx2a control Fig. S2 with imageFig. S7 with image from Won et al., 2015
exocrine pancreas development decreased process quality, abnormal AB + MO1-lnx2a control Fig. S5 with imageFig. S7 with image from Won et al., 2015
exocrine pancreas development disrupted, abnormal AB + MO1-lnx2a control Fig. 2 with imageFig. 5 with image from Won et al., 2015
exocrine pancreas ptf1a expression decreased distribution, abnormal AB + MO1-lnx2a control Fig. 2 with imageFig. 5 with image from Won et al., 2015
exocrine pancreas prss1 expression decreased amount, abnormal AB + MO1-lnx2a control Fig. 2 with imageFig. 5 with image from Won et al., 2015
anterior pancreatic bud mnx2a expression decreased distribution, abnormal AB + MO1-lnx2a control Fig. S2 with imageFig. S7 with image from Won et al., 2015
exocrine pancreas prss1 expression decreased distribution, abnormal AB + MO1-lnx2a control Fig. 2 with imageFig. 5 with image from Won et al., 2015
anterior pancreatic bud EGFP expression decreased distribution, abnormal jh1Tg + MO1-lnx2a control Fig. 7 with imageFig. S2 with image from Won et al., 2015
anterior pancreatic bud cell population proliferation decreased process quality, abnormal jh1Tg + MO1-lnx2a control Fig. 7 with image from Won et al., 2015
pancreatic bud numb expression increased distribution, abnormal jh1Tg + MO1-lnx2a control Fig. 7 with image from Won et al., 2015
pancreas mCherry expression decreased distribution, abnormal s939Tg; s940Tg + MO1-lnx2a control Fig. 6 with image from Won et al., 2015
pancreas numb expression increased distribution, abnormal s939Tg; s940Tg + MO1-lnx2a control Fig. 6 with image from Won et al., 2015
pancreas Venus expression decreased distribution, abnormal s939Tg; s940Tg + MO1-lnx2a control Fig. 6 with image from Won et al., 2015
exocrine pancreas development process quality, ameliorated AB + MO1-lnx2a + MO4-numb standard conditions Fig. 5 with imageFig. S5 with image from Won et al., 2015
exocrine pancreas ptf1a expression amount, ameliorated AB + MO1-lnx2a + MO4-numb control Fig. 5 with image from Won et al., 2015
exocrine pancreas prss1 expression amount, ameliorated AB + MO1-lnx2a + MO4-numb control Fig. 5 with image from Won et al., 2015
exocrine pancreas prss1 expression spatial pattern, ameliorated AB + MO1-lnx2a + MO4-numb control Fig. 5 with image from Won et al., 2015
exocrine pancreas ptf1a expression spatial pattern, ameliorated AB + MO1-lnx2a + MO4-numb control Fig. 5 with image from Won et al., 2015
pancreas Venus expression spatial pattern, ameliorated s939Tg; s940Tg + MO1-lnx2a + MO4-numb control Fig. 6 with image from Won et al., 2015
pancreas numb expression spatial pattern, ameliorated s939Tg; s940Tg + MO1-lnx2a + MO4-numb control Fig. 6 with image from Won et al., 2015
pancreas mCherry expression spatial pattern, ameliorated s939Tg; s940Tg + MO1-lnx2a + MO4-numb control Fig. 6 with image from Won et al., 2015
Citations