Morpholino

MO2-mt2

ID

ZDB-MRPHLNO-160114-3

Name

MO2-mt2

Previous Names

None

Target

mt2 (1)

Sequence

5' - AGCTGAAACACTTACTCTTGGCACA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-mt2

Expressed Gene	Anatomy	Figures
vegfc	head whole organism	Fig. 4 from Schuermann et al., 2015

Phenotype

Phenotype resulting from MO2-mt2

Phenotype	Fish	Figures
anterior cardinal vein endothelial cell decreased amount, abnormal	s843Tg + MO2-mt2	Fig. S1 from Schuermann et al., 2015
common cardinal vein malformed, abnormal	s843Tg + MO2-mt2	Fig. S1 from Schuermann et al., 2015
common cardinal vein blood vessel development decreased occurrence, abnormal	s843Tg + MO2-mt2	Fig. S1 from Schuermann et al., 2015
common cardinal vein endothelial cell decreased amount, abnormal	s843Tg + MO2-mt2	Fig. S1 from Schuermann et al., 2015
head vegfc expression decreased amount, abnormal	WT + MO2-mt2	Fig. 4 from Schuermann et al., 2015
intersegmental vessel malformed, abnormal	s843Tg + MO2-mt2	Fig. S1 from Schuermann et al., 2015
intersegmental vessel blood vessel development decreased occurrence, abnormal	s843Tg + MO2-mt2	Fig. S1 from Schuermann et al., 2015
intersegmental vessel endothelial cell decreased amount, abnormal	s843Tg + MO2-mt2	Fig. S1 from Schuermann et al., 2015
posterior cardinal vein endothelial cell decreased amount, abnormal	s843Tg + MO2-mt2	Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel aplastic, abnormal	s843Tg + MO2-mt2	Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel angiogenesis arrested, abnormal	s843Tg + MO2-mt2	Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel endothelial cell decreased amount, abnormal	y7Tg + MO2-mt2	Fig. 1 from Schuermann et al., 2015
whole organism vegfc expression decreased amount, abnormal	WT + MO2-mt2	Fig. 4 from Schuermann et al., 2015

Phenotype of all Fish created by or utilizing MO2-mt2

Phenotype	Fish	Conditions	Figures
head vegfc expression decreased amount, abnormal	WT + MO2-mt2	standard conditions	Fig. 4 from Schuermann et al., 2015
whole organism vegfc expression decreased amount, abnormal	WT + MO2-mt2	standard conditions	Fig. 4 from Schuermann et al., 2015
common cardinal vein blood vessel development decreased occurrence, abnormal	s843Tg + MO2-mt2	control	Fig. S1 from Schuermann et al., 2015
anterior cardinal vein endothelial cell decreased amount, abnormal	s843Tg + MO2-mt2	control	Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel angiogenesis arrested, abnormal	s843Tg + MO2-mt2	control	Fig. S1 from Schuermann et al., 2015
intersegmental vessel malformed, abnormal	s843Tg + MO2-mt2	control	Fig. S1 from Schuermann et al., 2015
intersegmental vessel endothelial cell decreased amount, abnormal	s843Tg + MO2-mt2	control	Fig. S1 from Schuermann et al., 2015
posterior cardinal vein endothelial cell decreased amount, abnormal	s843Tg + MO2-mt2	control	Fig. S1 from Schuermann et al., 2015
intersegmental vessel blood vessel development decreased occurrence, abnormal	s843Tg + MO2-mt2	control	Fig. S1 from Schuermann et al., 2015
common cardinal vein malformed, abnormal	s843Tg + MO2-mt2	control	Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel aplastic, abnormal	s843Tg + MO2-mt2	control	Fig. S1 from Schuermann et al., 2015
common cardinal vein endothelial cell decreased amount, abnormal	s843Tg + MO2-mt2	control	Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel endothelial cell decreased amount, abnormal	y7Tg + MO2-mt2	standard conditions	Fig. 1 from Schuermann et al., 2015

Citations