Morpholino

MO1-mt2

ID
ZDB-MRPHLNO-160114-2
Name
MO1-mt2
Previous Names
None
Target
Sequence
5' - GGTCCATTTTTCCAGAGAGTATCCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mt2
Expressed Gene Anatomy Figures
dct Fig. 4 with image from Xia et al., 2022
Phenotype
Phenotype resulting from MO1-mt2
Phenotype Fish Figures
anterior cardinal vein endothelial cell decreased amount, abnormal s843Tg + MO1-mt2 Fig. S1 from Schuermann et al., 2015
common cardinal vein malformed, abnormal s843Tg + MO1-mt2 Fig. S1 from Schuermann et al., 2015
common cardinal vein blood vessel development decreased occurrence, abnormal s843Tg + MO1-mt2 Fig. S1 from Schuermann et al., 2015
common cardinal vein cell population proliferation decreased occurrence, abnormal s843Tg + MO1-mt2 Fig. S2 from Schuermann et al., 2015
common cardinal vein endothelial cell decreased amount, abnormal s843Tg + MO1-mt2 Fig. S1 from Schuermann et al., 2015
eye melanoblast ab4-h3 labeling increased amount, abnormal WT + MO1-mt2 Fig. 4 with image from Xia et al., 2022
head necrotic, abnormal WT + MO1-mt2 Fig. 1 from Schuermann et al., 2015
intersegmental vessel malformed, abnormal s843Tg + MO1-mt2 Fig. S1 from Schuermann et al., 2015
intersegmental vessel blood vessel development decreased occurrence, abnormal s843Tg + MO1-mt2 Fig. S1 from Schuermann et al., 2015
intersegmental vessel endothelial cell decreased amount, abnormal s843Tg + MO1-mt2 Fig. S1 from Schuermann et al., 2015
melanocyte intracellular zinc ion homeostasis increased magnitude, abnormal WT + MO1-mt2 Fig. 4 with image from Xia et al., 2022
posterior cardinal vein endothelial cell decreased amount, abnormal s843Tg + MO1-mt2 Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel aplastic, abnormal s843Tg + MO1-mt2 Fig. 1Fig. 3Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel angiogenesis arrested, abnormal s843Tg + MO1-mt2 Fig. 1Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel blood vessel development arrested, abnormal s843Tg + MO1-mt2 Fig. 1 from Schuermann et al., 2015
primordial hindbrain channel blood vessel development decreased occurrence, abnormal s843Tg + MO1-mt2 Fig. 3 from Schuermann et al., 2015
primordial hindbrain channel cell migration involved in sprouting angiogenesis arrested, abnormal s843Tg + MO1-mt2 Fig. 1 from Schuermann et al., 2015
primordial hindbrain channel endothelial cell decreased amount, abnormal y7Tg + MO1-mt2 Fig. 1 from Schuermann et al., 2015
whole organism dct expression increased amount, abnormal WT + MO1-mt2 Fig. 4 with image from Xia et al., 2022
Phenotype of all Fish created by or utilizing MO1-mt2
Phenotype Fish Conditions Figures
trunk melanoblast dct expression increased amount, abnormal WT + MO1-mt2 chemical treatment by environment: N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine Fig. 4 with image from Xia et al., 2022
whole organism dct expression increased amount, abnormal WT + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
eye melanoblast ab4-h3 labeling increased amount, abnormal WT + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
melanocyte intracellular zinc ion homeostasis increased magnitude, abnormal WT + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
whole organism dct expression increased amount, abnormal WT + MO1-mt2 chemical treatment by environment: N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine Fig. 4 with image from Xia et al., 2022
head necrotic, abnormal WT + MO1-mt2 standard conditions Fig. 1 from Schuermann et al., 2015
common cardinal vein endothelial cell decreased amount, abnormal s843Tg + MO1-mt2 control Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel aplastic, abnormal s843Tg + MO1-mt2 control Fig. 1Fig. 3Fig. S1 from Schuermann et al., 2015
posterior cardinal vein endothelial cell decreased amount, abnormal s843Tg + MO1-mt2 control Fig. S1 from Schuermann et al., 2015
intersegmental vessel endothelial cell decreased amount, abnormal s843Tg + MO1-mt2 control Fig. S1 from Schuermann et al., 2015
common cardinal vein malformed, abnormal s843Tg + MO1-mt2 control Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel blood vessel development arrested, abnormal s843Tg + MO1-mt2 control Fig. 1 from Schuermann et al., 2015
anterior cardinal vein endothelial cell decreased amount, abnormal s843Tg + MO1-mt2 control Fig. S1 from Schuermann et al., 2015
common cardinal vein cell population proliferation decreased occurrence, abnormal s843Tg + MO1-mt2 control Fig. S2 from Schuermann et al., 2015
intersegmental vessel blood vessel development decreased occurrence, abnormal s843Tg + MO1-mt2 control Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel blood vessel development decreased occurrence, abnormal s843Tg + MO1-mt2 control Fig. 3 from Schuermann et al., 2015
intersegmental vessel malformed, abnormal s843Tg + MO1-mt2 control Fig. S1 from Schuermann et al., 2015
common cardinal vein blood vessel development decreased occurrence, abnormal s843Tg + MO1-mt2 control Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel cell migration involved in sprouting angiogenesis arrested, abnormal s843Tg + MO1-mt2 control Fig. 1 from Schuermann et al., 2015
primordial hindbrain channel angiogenesis arrested, abnormal s843Tg + MO1-mt2 control Fig. 1Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel endothelial cell decreased amount, abnormal y7Tg + MO1-mt2 standard conditions Fig. 1 from Schuermann et al., 2015
integument melanoblast ab4-h3 labeling increased amount, abnormal slc30a1azju32/zju32; slc30a1bzju34/zju34 + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
melanocyte intracellular zinc ion homeostasis increased magnitude, exacerbated slc30a1azju32/zju32; slc30a1bzju34/zju34 + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
trunk melanoblast dct expression increased distribution, abnormal slc30a1azju32/zju32; slc30a1bzju34/zju34 + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
eye melanoblast ab4-h3 labeling increased amount, abnormal slc30a1azju32/zju32; slc30a1bzju34/zju34 + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
trunk melanoblast dct expression amount, ameliorated slc30a1azju32/zju32; slc30a1bzju34/zju34 + MO1-mt2 chemical treatment by environment: N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine Fig. 4 with image from Xia et al., 2022
integument melanoblast ab4-h3 labeling increased amount, abnormal slc30a1azju32/zju32; slc30a1bzju35/zju35 + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
melanocyte intracellular zinc ion homeostasis increased magnitude, exacerbated slc30a1azju32/zju32; slc30a1bzju35/zju35 + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
trunk melanoblast dct expression amount, ameliorated slc30a1azju32/zju32; slc30a1bzju35/zju35 + MO1-mt2 chemical treatment by environment: N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine Fig. 4 with image from Xia et al., 2022
trunk melanoblast dct expression increased distribution, abnormal slc30a1azju32/zju32; slc30a1bzju35/zju35 + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
eye melanoblast ab4-h3 labeling increased amount, abnormal slc30a1azju32/zju32; slc30a1bzju35/zju35 + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
integument melanoblast ab4-h3 labeling increased amount, abnormal slc30a1azju33/zju33; slc30a1bzju34/zju34 + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
melanocyte intracellular zinc ion homeostasis increased magnitude, exacerbated slc30a1azju33/zju33; slc30a1bzju34/zju34 + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
trunk melanoblast dct expression increased distribution, abnormal slc30a1azju33/zju33; slc30a1bzju34/zju34 + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
eye melanoblast ab4-h3 labeling increased amount, abnormal slc30a1azju33/zju33; slc30a1bzju34/zju34 + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
trunk melanoblast dct expression amount, ameliorated slc30a1azju33/zju33; slc30a1bzju34/zju34 + MO1-mt2 chemical treatment by environment: N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine Fig. 4 with image from Xia et al., 2022
eye melanoblast ab4-h3 labeling increased amount, abnormal slc30a1azju33/zju33; slc30a1bzju35/zju35 + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
integument melanoblast ab4-h3 labeling increased amount, abnormal slc30a1azju33/zju33; slc30a1bzju35/zju35 + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
trunk melanoblast dct expression increased distribution, abnormal slc30a1azju33/zju33; slc30a1bzju35/zju35 + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
trunk melanoblast dct expression amount, ameliorated slc30a1azju33/zju33; slc30a1bzju35/zju35 + MO1-mt2 chemical treatment by environment: N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine Fig. 4 with image from Xia et al., 2022
melanocyte intracellular zinc ion homeostasis increased magnitude, exacerbated slc30a1azju33/zju33; slc30a1bzju35/zju35 + MO1-mt2 standard conditions Fig. 4 with image from Xia et al., 2022
Citations