Morpholino

MO1-pkn2a

ID
ZDB-MRPHLNO-151112-3
Name
MO1-pkn2a
Previous Names
  • MO1-pkn2
Target
Sequence
5' - AGCTTTACTCATACCCAAGAGAAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pkn2a
No data available
Phenotype
Phenotype resulting from MO1-pkn2a
Phenotype Fish Figures
brain edematous, abnormal WT + MO1-pkn2a Fig. S7 from Fitzgerald et al., 2015
cranial cartilage absent, abnormal WT + MO1-pkn2a Fig. S7 from Fitzgerald et al., 2015
cranial cartilage decreased size, abnormal WT + MO1-pkn2a Fig. S7 from Fitzgerald et al., 2015
eye decreased size, abnormal WT + MO1-pkn2a Fig. S7 from Fitzgerald et al., 2015
head decreased size, abnormal WT + MO1-pkn2a Fig. S7 from Fitzgerald et al., 2015
head malformed, abnormal WT + MO1-pkn2a Fig. S7 from Fitzgerald et al., 2015
head morphology, abnormal WT + MO1-pkn2a Fig. S7 from Fitzgerald et al., 2015
heart morphology, abnormal WT + MO1-pkn2a Fig. S7 from Fitzgerald et al., 2015
melanocyte decreased amount, abnormal WT + MO1-pkn2a Fig. S7 from Fitzgerald et al., 2015
pericardium edematous, abnormal WT + MO1-pkn2a Fig. S7 from Fitzgerald et al., 2015
trunk curved ventral, abnormal WT + MO1-pkn2a Fig. S7 from Fitzgerald et al., 2015
ventral mandibular arch decreased size, abnormal WT + MO1-pkn2a Fig. 4,  Fig. S7 from Fitzgerald et al., 2015
whole organism anatomical axis decreased length, abnormal WT + MO1-pkn2a Fig. S7 from Fitzgerald et al., 2015
Phenotype of all Fish created by or utilizing MO1-pkn2a
Phenotype Fish Conditions Figures
ventral mandibular arch decreased size, abnormal WT + MO1-pkn2a standard conditions Fig. 4,  Fig. S7 from Fitzgerald et al., 2015
cranial cartilage decreased size, abnormal WT + MO1-pkn2a standard conditions Fig. S7 from Fitzgerald et al., 2015
brain edematous, abnormal WT + MO1-pkn2a standard conditions Fig. S7 from Fitzgerald et al., 2015
heart morphology, abnormal WT + MO1-pkn2a standard conditions Fig. S7 from Fitzgerald et al., 2015
head morphology, abnormal WT + MO1-pkn2a standard conditions Fig. S7 from Fitzgerald et al., 2015
melanocyte decreased amount, abnormal WT + MO1-pkn2a standard conditions Fig. S7 from Fitzgerald et al., 2015
head decreased size, abnormal WT + MO1-pkn2a standard conditions Fig. S7 from Fitzgerald et al., 2015
cranial cartilage absent, abnormal WT + MO1-pkn2a standard conditions Fig. S7 from Fitzgerald et al., 2015
trunk curved ventral, abnormal WT + MO1-pkn2a standard conditions Fig. S7 from Fitzgerald et al., 2015
pericardium edematous, abnormal WT + MO1-pkn2a standard conditions Fig. S7 from Fitzgerald et al., 2015
eye decreased size, abnormal WT + MO1-pkn2a standard conditions Fig. S7 from Fitzgerald et al., 2015
whole organism anatomical axis decreased length, abnormal WT + MO1-pkn2a standard conditions Fig. S7 from Fitzgerald et al., 2015
head malformed, abnormal WT + MO1-pkn2a standard conditions Fig. S7 from Fitzgerald et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.