Morpholino

MO1-nono

ID
ZDB-MRPHLNO-151112-2
Name
MO1-nono
Previous Names
None
Target
Sequence
5' - TGACGCCTAACCAAACTCACCAGCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nono
No data available
Phenotype
Phenotype resulting from MO1-nono
Phenotype Fish Figures
brain decreased size, abnormal WT + MO1-nono Fig. S7 from Fitzgerald et al., 2015
central nervous system decreased size, abnormal WT + MO1-nono Fig. S7 from Fitzgerald et al., 2015
embryo development arrested, abnormal WT + MO1-nono Fig. S7 from Fitzgerald et al., 2015
eye decreased size, abnormal WT + MO1-nono Fig. S7 from Fitzgerald et al., 2015
head decreased size, abnormal WT + MO1-nono Fig. S7 from Fitzgerald et al., 2015
otic vesicle decreased size, abnormal WT + MO1-nono Fig. S7 from Fitzgerald et al., 2015
pericardium decreased size, abnormal WT + MO1-nono Fig. S7 from Fitzgerald et al., 2015
somite absent, abnormal WT + MO1-nono Fig. S7 from Fitzgerald et al., 2015
somite morphology, abnormal WT + MO1-nono Fig. S7 from Fitzgerald et al., 2015
trunk decreased length, abnormal WT + MO1-nono Fig. S7 from Fitzgerald et al., 2015
trunk increased thickness, abnormal WT + MO1-nono Fig. S7 from Fitzgerald et al., 2015
whole organism apoptotic, abnormal WT + MO1-nono Fig. S7 from Fitzgerald et al., 2015
whole organism morphology, abnormal WT + MO1-nono Fig. S7 from Fitzgerald et al., 2015
Phenotype of all Fish created by or utilizing MO1-nono
Phenotype Fish Conditions Figures
somite absent, abnormal WT + MO1-nono standard conditions Fig. S7 from Fitzgerald et al., 2015
otic vesicle decreased size, abnormal WT + MO1-nono standard conditions Fig. S7 from Fitzgerald et al., 2015
embryo development arrested, abnormal WT + MO1-nono standard conditions Fig. S7 from Fitzgerald et al., 2015
brain decreased size, abnormal WT + MO1-nono standard conditions Fig. S7 from Fitzgerald et al., 2015
pericardium decreased size, abnormal WT + MO1-nono standard conditions Fig. S7 from Fitzgerald et al., 2015
trunk increased thickness, abnormal WT + MO1-nono standard conditions Fig. S7 from Fitzgerald et al., 2015
trunk decreased length, abnormal WT + MO1-nono standard conditions Fig. S7 from Fitzgerald et al., 2015
somite morphology, abnormal WT + MO1-nono standard conditions Fig. S7 from Fitzgerald et al., 2015
head decreased size, abnormal WT + MO1-nono standard conditions Fig. S7 from Fitzgerald et al., 2015
eye decreased size, abnormal WT + MO1-nono standard conditions Fig. S7 from Fitzgerald et al., 2015
whole organism morphology, abnormal WT + MO1-nono standard conditions Fig. S7 from Fitzgerald et al., 2015
whole organism apoptotic, abnormal WT + MO1-nono standard conditions Fig. S7 from Fitzgerald et al., 2015
central nervous system decreased size, abnormal WT + MO1-nono standard conditions Fig. S7 from Fitzgerald et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.