Morpholino

MO6-vsx2

ID

ZDB-MRPHLNO-151005-2

Name

MO6-vsx2

Previous Names

Target

Sequence

5' - TTTTCTTTAAGCCCACCTGTGTCGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO6-vsx2

Expressed Gene	Anatomy	Figures
ofcc1	whole organism	Fig. 5 from Gago-Rodrigues et al., 2015

Phenotype

Phenotype resulting from MO6-vsx2

Phenotype	Fish	Figures
eye closure incomplete, abnormal	upo334Tg + MO4-tp53 + MO6-vsx2	Fig. 7 from Gago-Rodrigues et al., 2015
eye decreased size, abnormal	upo334Tg + MO4-tp53 + MO6-vsx2	Fig. 6 from Gago-Rodrigues et al., 2015
eye open, abnormal	upo334Tg + MO4-tp53 + MO6-vsx2	Fig. 6 from Gago-Rodrigues et al., 2015
optic cup EGFP expression decreased amount, abnormal	upo325Tg + MO6-vsx2	Fig. 4 from Gago-Rodrigues et al., 2015
optic cup formation involved in camera-type eye development process quality, abnormal	upo334Tg + MO4-tp53 + MO6-vsx2	Fig. 6, Fig. 7 from Gago-Rodrigues et al., 2015
whole organism ofcc1 expression decreased amount, abnormal	WT + MO6-vsx2	Fig. 5 from Gago-Rodrigues et al., 2015
whole organism lacks parts or has fewer parts of type eye, abnormal	upo334Tg + MO4-tp53 + MO6-vsx2	Fig. 6 from Gago-Rodrigues et al., 2015

Phenotype of all Fish created by or utilizing MO6-vsx2

Phenotype	Fish	Conditions	Figures
head ofcc1 expression decreased amount, abnormal	WT + MO5-vsx2 + MO6-vsx2	standard conditions	Fig. 5 from Gago-Rodrigues et al., 2015
whole organism ofcc1 expression decreased amount, abnormal	WT + MO5-vsx2 + MO6-vsx2	standard conditions	Fig. 5 from Gago-Rodrigues et al., 2015
whole organism ofcc1 expression decreased amount, abnormal	WT + MO6-vsx2	standard conditions	Fig. 5 from Gago-Rodrigues et al., 2015
optic cup EGFP expression decreased amount, abnormal	upo325Tg + MO6-vsx2	standard conditions	Fig. 4 from Gago-Rodrigues et al., 2015
eye open, abnormal	upo334Tg + MO4-tp53 + MO6-vsx2	standard conditions	Fig. 6 from Gago-Rodrigues et al., 2015
whole organism lacks parts or has fewer parts of type eye, abnormal	upo334Tg + MO4-tp53 + MO6-vsx2	standard conditions	Fig. 6 from Gago-Rodrigues et al., 2015
optic cup formation involved in camera-type eye development process quality, abnormal	upo334Tg + MO4-tp53 + MO6-vsx2	standard conditions	Fig. 6, Fig. 7 from Gago-Rodrigues et al., 2015
eye closure incomplete, abnormal	upo334Tg + MO4-tp53 + MO6-vsx2	standard conditions	Fig. 7 from Gago-Rodrigues et al., 2015
eye decreased size, abnormal	upo334Tg + MO4-tp53 + MO6-vsx2	standard conditions	Fig. 6 from Gago-Rodrigues et al., 2015

Citations