Morpholino

MO2-bptf

ID
ZDB-MRPHLNO-150923-2
Name
MO2-bptf
Previous Names
None
Target
Sequence
5' - GCGGCCTGCCTCGTCTCCCCCTCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-bptf
Expressed Gene Anatomy Figures
bptf Fig. 1 from Ma et al., 2015
myb Fig. 2 from Ding et al., 2020
Phenotype
Phenotype resulting from MO2-bptf
Phenotype Fish Figures
whole organism bptf expression decreased amount, abnormal TU + MO2-bptf Fig. 1 from Ma et al., 2015
Phenotype of all Fish created by or utilizing MO2-bptf
Phenotype Fish Conditions Figures
whole organism bptf expression decreased amount, abnormal TU + MO2-bptf control Fig. 1 from Ma et al., 2015
ATP-dependent histone chaperone activity process quality, abnormal TU + MO2-bptf + MO3-bptf control Fig. 9 from Ma et al., 2015
margin wnt8a expression decreased amount, abnormal TU + MO2-bptf + MO3-bptf control Fig. 5,  Fig. 8 from Ma et al., 2015
forebrain neural keel increased size, abnormal TU + MO2-bptf + MO3-bptf control Fig. 2 from Ma et al., 2015
neuroectoderm anterior region increased size, abnormal TU + MO2-bptf + MO3-bptf control Fig. 2 from Ma et al., 2015
neuroectoderm anterior region sox2 expression increased distribution, abnormal TU + MO2-bptf + MO3-bptf control Fig. 2 from Ma et al., 2015
neuroectoderm posterior region hoxb1b expression decreased distribution, abnormal TU + MO2-bptf + MO3-bptf control Fig. 2,  Fig. 6,  Fig. 8 from Ma et al., 2015
margin wnt8a expression absent, abnormal TU + MO2-bptf + MO3-bptf control Fig. 5 from Ma et al., 2015
forebrain increased size, abnormal TU + MO2-bptf + MO3-bptf standard conditions Fig. 1 from Ma et al., 2015
neuroectoderm anterior region otx2b expression increased distribution, abnormal TU + MO2-bptf + MO3-bptf control Fig. 2,  Fig. 6 from Ma et al., 2015
neuroectoderm anterior region sox3 expression increased distribution, abnormal TU + MO2-bptf + MO3-bptf control Fig. 2 from Ma et al., 2015
neuroectoderm posterior region decreased size, abnormal TU + MO2-bptf + MO3-bptf control Fig. 2 from Ma et al., 2015
whole organism bptf expression decreased amount, abnormal TU + MO2-bptf + MO3-bptf control Fig. 1 from Ma et al., 2015
neuroectoderm posterior region sox3 expression decreased distribution, abnormal TU + MO2-bptf + MO3-bptf control Fig. 2 from Ma et al., 2015
spinal cord neural keel shha expression decreased distribution, abnormal TU + MO2-bptf + MO3-bptf control Fig. 2 from Ma et al., 2015
spinal cord neural keel decreased size, abnormal TU + MO2-bptf + MO3-bptf control Fig. 2 from Ma et al., 2015
trunk decreased size, abnormal TU + MO2-bptf + MO3-bptf standard conditions Fig. 1 from Ma et al., 2015
presumptive mesoderm ventro-lateral region GFP expression decreased amount, abnormal w25Tg + MO2-bptf + MO3-bptf control Fig. 6 from Ma et al., 2015
mesoderm ventro-lateral region GFP expression decreased amount, abnormal w25Tg + MO2-bptf + MO3-bptf control Fig. 6 from Ma et al., 2015
margin wnt8a expression decreased amount, abnormal tdgf1tz257/tz257 + MO2-bptf + MO3-bptf control Fig. 5 from Ma et al., 2015
neuroectoderm anterior region sox2 expression spatial pattern, abnormal tdgf1tz257/tz257 + MO2-bptf + MO3-bptf control Fig. 3 from Ma et al., 2015
neuroectoderm posterior region hoxb1b expression decreased distribution, abnormal tdgf1tz257/tz257 + MO2-bptf + MO3-bptf control Fig. 3,  Fig. 6 from Ma et al., 2015
neuroectoderm anterior region otx2b expression increased distribution, abnormal tdgf1tz257/tz257 + MO2-bptf + MO3-bptf control Fig. 6 from Ma et al., 2015
neuroectoderm posterior region sox2 expression mislocalised, abnormal tdgf1tz257/tz257 + MO2-bptf + MO3-bptf control Fig. 3 from Ma et al., 2015
neuroectoderm anterior region otx2b expression spatial pattern, abnormal tdgf1tz257/tz257 + MO2-bptf + MO3-bptf control Fig. 3 from Ma et al., 2015
trunk decreased size, abnormal tp53zdf1/zdf1 + MO2-bptf + MO3-bptf standard conditions Fig. 1 from Ma et al., 2015
neuroectoderm posterior region hoxb1b expression decreased distribution, abnormal tp53zdf1/zdf1 + MO2-bptf + MO3-bptf control Fig. 2 from Ma et al., 2015
forebrain increased size, abnormal tp53zdf1/zdf1 + MO2-bptf + MO3-bptf standard conditions Fig. 1 from Ma et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.