Morpholino

MO1-adgra2

ID

ZDB-MRPHLNO-150904-2

Name

MO1-adgra2

Previous Names

None

Target

adgra2 (1)

Sequence

5' - ACTGATATTGATTTAACTCACCACA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-adgra2

No data available

Phenotype

Phenotype resulting from MO1-adgra2

Phenotype	Fish	Figures
brain central artery EGFP expression spatial pattern, abnormal	s843Tg/s843Tg + MO1-adgra2	Fig. 1 from America et al., 2022
central artery absent, abnormal	s843Tg + MO1-adgra2	Fig. 3 from Vanhollebeke et al., 2015
central artery decreased amount, abnormal	WT + MO1-adgra2	Fig. 4, Fig. 5 from Eubelen et al., 2018
central artery Wnt receptor activity decreased efficacy, abnormal	s843Tg/s843Tg + MO1-adgra2	Fig. 1 , Fig. 7 from America et al., 2022
central artery Wnt-Frizzled-LRP5/6 complex decreased functionality, abnormal	s843Tg/s843Tg + MO1-adgra2	Fig. 7 from America et al., 2022
dorsal root ganglion decreased amount, abnormal	sb1Tg; vu234Tg + MO1-adgra2	Fig. 2 from Bostaille et al., 2017 Fig. 3 from Vanhollebeke et al., 2015
dorsal root ganglion Wnt signaling pathway decreased process quality, abnormal	ia4Tg; vu234Tg + MO1-adgra2	Fig. 3 from Vanhollebeke et al., 2015
hindbrain brain vasculature decreased amount, abnormal	WT + MO1-adgra2	Fig. 4, Fig. 5 from Eubelen et al., 2018
hindbrain central artery absent, abnormal	ia4Tg; s896Tg + MO1-adgra2	Fig. 3 from Vanhollebeke et al., 2015
hindbrain central artery decreased amount, abnormal	ia4Tg; s896Tg + MO1-adgra2	Fig. 2 from Bostaille et al., 2017 Fig. 1 , Fig. 3 from Vanhollebeke et al., 2015
hindbrain central artery irregular spatial pattern, abnormal	s843Tg/s843Tg + MO1-adgra2	Fig. 7 from America et al., 2022
hindbrain central artery EGFP expression spatial pattern, abnormal	s843Tg/s843Tg + MO1-adgra2	Fig. 4 , Fig. 7 from America et al., 2022
hindbrain vasculature EGFP expression decreased amount, abnormal	ia4Tg + MO1-adgra2	Fig. 5 from Fetsko et al., 2022
primordial hindbrain channel EGFP expression spatial pattern, abnormal	s843Tg/s843Tg + MO1-adgra2	Fig. 4 , Fig. 7 from America et al., 2022
primordial hindbrain channel Wnt signaling pathway decreased process quality, abnormal	ia4Tg; s896Tg + MO1-adgra2	Fig. 3 from Vanhollebeke et al., 2015

Phenotype of all Fish created by or utilizing MO1-adgra2

Phenotype	Fish	Conditions	Figures
brain central artery EGFP expression spatial pattern, abnormal	s843Tg/s843Tg + MO1-adgra2	standard conditions	Fig. 1 from America et al., 2022
primordial hindbrain channel EGFP expression spatial pattern, abnormal	s843Tg/s843Tg + MO1-adgra2	standard conditions	Fig. 4 , Fig. 7 from America et al., 2022
hindbrain central artery irregular spatial pattern, abnormal	s843Tg/s843Tg + MO1-adgra2	standard conditions	Fig. 7 from America et al., 2022
central artery Wnt-Frizzled-LRP5/6 complex decreased functionality, abnormal	s843Tg/s843Tg + MO1-adgra2	standard conditions	Fig. 7 from America et al., 2022
central artery Wnt receptor activity decreased efficacy, abnormal	s843Tg/s843Tg + MO1-adgra2	standard conditions	Fig. 1 , Fig. 7 from America et al., 2022
hindbrain central artery EGFP expression spatial pattern, abnormal	s843Tg/s843Tg + MO1-adgra2	standard conditions	Fig. 4 , Fig. 7 from America et al., 2022
hindbrain brain vasculature decreased amount, abnormal	WT + MO1-adgra2	control	Fig. 4, Fig. 5 from Eubelen et al., 2018
central artery decreased amount, abnormal	WT + MO1-adgra2	control	Fig. 4, Fig. 5 from Eubelen et al., 2018
hindbrain central artery decreased amount, abnormal	WT + MO1-adgra2	standard conditions	Fig. 2 from Bostaille et al., 2017
hindbrain vasculature EGFP expression decreased amount, abnormal	ia4Tg + MO1-adgra2	standard conditions	Fig. 5 from Fetsko et al., 2022
central artery absent, abnormal	s843Tg + MO1-adgra2	control	Fig. 3 from Vanhollebeke et al., 2015
hindbrain central artery decreased amount, abnormal	s843Tg + MO1-adgra2	standard conditions	Fig. 1 from Vanhollebeke et al., 2015
dorsal root ganglion decreased amount, abnormal	w61Tg + MO1-adgra2	standard conditions	Fig. 2 from Bostaille et al., 2017
hindbrain central artery absent, abnormal	ia4Tg; s896Tg + MO1-adgra2	standard conditions	Fig. 3 from Vanhollebeke et al., 2015
hindbrain central artery decreased amount, abnormal	ia4Tg; s896Tg + MO1-adgra2	standard conditions	Fig. 3 from Vanhollebeke et al., 2015
primordial hindbrain channel Wnt signaling pathway decreased process quality, abnormal	ia4Tg; s896Tg + MO1-adgra2	standard conditions	Fig. 3 from Vanhollebeke et al., 2015
dorsal root ganglion Wnt signaling pathway decreased process quality, abnormal	ia4Tg; vu234Tg + MO1-adgra2	standard conditions	Fig. 3 from Vanhollebeke et al., 2015
dorsal root ganglion decreased amount, abnormal	sb1Tg; vu234Tg + MO1-adgra2	control	Fig. 3 from Vanhollebeke et al., 2015
primordial hindbrain channel Wnt signaling pathway decreased process quality, abnormal	ncv15Tg; ncv1Tg; nkuasgfp1aTg + MO1-adgra2	standard conditions	Fig. 3 from Vanhollebeke et al., 2015
basilar artery Wnt signaling pathway decreased process quality, abnormal	ncv15Tg; ncv1Tg; nkuasgfp1aTg + MO1-adgra2	standard conditions	Fig. 3 from Vanhollebeke et al., 2015

Citations