Morpholino

MO1-pleca

ID

ZDB-MRPHLNO-150622-8

Name

MO1-pleca

Previous Names

None

Target

Sequence

5' - GCCCTTCTTCCTTTGTTTACCTTCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-pleca

No data available

Phenotype

Phenotype resulting from MO1-pleca

Phenotype	Fish	Figures
locomotion disrupted, abnormal	WT + MO1-pleca	Fig. 2 from B�hrdel et al., 2015
neuromast ribbon synapse decreased amount, abnormal	nl1Tg + MO1-pleca	Fig. 7 from Zhang et al., 2023
neuromast hair cell mitochondrion decreased functionality, abnormal	nl1Tg + MO1-pleca	Fig. 8 from Zhang et al., 2023
neuromast hair cell postsynapse ab1-pan-maguk labeling decreased amount, abnormal	nl1Tg + MO1-pleca	Fig. 7 from Zhang et al., 2023
neuromast hair cell presynapse ab4-ctbp2l labeling decreased amount, abnormal	nl1Tg + MO1-pleca	Fig. 7 from Zhang et al., 2023
pericardium edematous, abnormal	WT + MO1-pleca	Fig. S4 from B�hrdel et al., 2015
skeletal muscle refractivity, abnormal	WT + MO1-pleca	Fig. S4 from B�hrdel et al., 2015
thigmotaxis disrupted, abnormal	WT + MO1-pleca	Fig. 2 from B�hrdel et al., 2015
trunk curved, abnormal	WT + MO1-pleca	Fig. S4 from B�hrdel et al., 2015
whole organism decreased mobility, abnormal	WT + MO1-pleca	Fig. 2 from B�hrdel et al., 2015

Phenotype of all Fish created by or utilizing MO1-pleca

Phenotype	Fish	Conditions	Figures
thigmotaxis disrupted, abnormal	WT + MO1-pleca	standard conditions	Fig. 2 from B�hrdel et al., 2015
pericardium edematous, abnormal	WT + MO1-pleca	standard conditions	Fig. S4 from B�hrdel et al., 2015
whole organism decreased mobility, abnormal	WT + MO1-pleca	standard conditions	Fig. 2 from B�hrdel et al., 2015
trunk curved, abnormal	WT + MO1-pleca	standard conditions	Fig. S4 from B�hrdel et al., 2015
skeletal muscle refractivity, abnormal	WT + MO1-pleca	standard conditions	Fig. S4 from B�hrdel et al., 2015
locomotion disrupted, abnormal	WT + MO1-pleca	standard conditions	Fig. 2 from B�hrdel et al., 2015
neuromast hair cell mitochondrion decreased functionality, abnormal	nl1Tg + MO1-pleca	control	Fig. 8 from Zhang et al., 2023
neuromast hair cell postsynapse ab1-pan-maguk labeling decreased amount, abnormal	nl1Tg + MO1-pleca	standard conditions	Fig. 7 from Zhang et al., 2023
neuromast hair cell presynapse ab4-ctbp2l labeling decreased amount, abnormal	nl1Tg + MO1-pleca	standard conditions	Fig. 7 from Zhang et al., 2023
neuromast ribbon synapse decreased amount, abnormal	nl1Tg + MO1-pleca	standard conditions	Fig. 7 from Zhang et al., 2023
neuromast hair cell presynapse ab4-ctbp2l labeling decreased amount, abnormal	nl1Tg + MO1-pleca + MO1-plecb	standard conditions	Fig. 7 from Zhang et al., 2023
neuromast hair cell mitochondrion decreased functionality, abnormal	nl1Tg + MO1-pleca + MO1-plecb	control	Fig. 8 from Zhang et al., 2023

Citations