Morpholino
MO1-ttc12
- ID
- ZDB-MRPHLNO-150622-14
- Name
- MO1-ttc12
- Previous Names
- None
- Target
- Sequence
-
5' - AGACATGGTTGAAACAGAGTTCATA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ttc12
No data available
Phenotype
Phenotype resulting from MO1-ttc12
Phenotype of all Fish created by or utilizing MO1-ttc12
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
post-vent region curved, abnormal | AB + MO1-ttc12 | control |
Fig. 3
from Chen et al., 2022 |
heart mislocalised, abnormal | AB + MO1-ttc12 | control |
Fig. 3
from Chen et al., 2022 |
pronephros cilium decreased amount, abnormal | AB + MO1-ttc12 | control |
Fig. 3
from Chen et al., 2022 |
pericardium edematous, abnormal | AB + MO1-ttc12 | control |
Fig. 3
from Chen et al., 2022 |
heart determination of heart left/right asymmetry decreased process quality, abnormal | AB + MO1-ttc12 | control |
Fig. 3
from Chen et al., 2022 |
caudal fin cilium decreased amount, abnormal | AB + MO1-ttc12 | control |
Fig. 3
from Chen et al., 2022 |
Citations