Morpholino

MO1-znf385c

ID

ZDB-MRPHLNO-150601-1

Name

MO1-znf385c

Previous Names

None

Target

znf385c (1)

Sequence

5' - GCATGTTGTGAAAAGGTAGGCTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO. This morpholino contains a single nucleotide mismatch when blasted in Ensembl. This is probably due to a polymorphism in this region.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-znf385c

Expressed Gene	Anatomy	Figures
cdkn1a	mandibular arch skeleton	Fig. 4 from Hochgreb-Hägele et al., 2015

Phenotype

Phenotype resulting from MO1-znf385c

Phenotype	Fish	Figures
ceratohyal cartilage decreased size, abnormal	ba2Tg + MO1-znf385c	Fig. 2 from Hochgreb-Hägele et al., 2015
forebrain apoptotic, abnormal	WT + MO1-znf385c	Fig. 3 from Hochgreb-Hägele et al., 2015
head decreased size, abnormal	WT + MO1-znf385c	Fig. 2 from Hochgreb-Hägele et al., 2015
head chondrocyte decreased amount, abnormal	ba2Tg + MO1-znf385c	Fig. 2 from Hochgreb-Hägele et al., 2015
head chondrocyte maturity, abnormal	ba2Tg + MO1-znf385c	Fig. 2 from Hochgreb-Hägele et al., 2015
heart apoptotic, abnormal	WT + MO1-znf385c	Fig. 3 from Hochgreb-Hägele et al., 2015
heart edematous, abnormal	WT + MO1-znf385c	Fig. 2 from Hochgreb-Hägele et al., 2015
hindbrain apoptotic, abnormal	WT + MO1-znf385c	Fig. 3 from Hochgreb-Hägele et al., 2015
mandibular arch skeleton atrophied, abnormal	ba2Tg + MO1-znf385c	Fig. 2 from Hochgreb-Hägele et al., 2015
Meckel's cartilage decreased width, abnormal	WT + MO1-znf385c	Fig. 2 from Hochgreb-Hägele et al., 2015
Meckel's cartilage endochondral ossification premature, abnormal	WT + MO1-znf385c	Fig. 2 from Hochgreb-Hägele et al., 2015
pharyngeal arch apoptotic, abnormal	WT + MO1-znf385c	Fig. 3 from Hochgreb-Hägele et al., 2015

Phenotype of all Fish created by or utilizing MO1-znf385c

Phenotype	Fish	Conditions	Figures
hindbrain apoptotic, abnormal	WT + MO1-znf385c	standard conditions	Fig. 3 from Hochgreb-Hägele et al., 2015
heart apoptotic, abnormal	WT + MO1-znf385c	standard conditions	Fig. 3 from Hochgreb-Hägele et al., 2015
Meckel's cartilage endochondral ossification premature, abnormal	WT + MO1-znf385c	standard conditions	Fig. 2 from Hochgreb-Hägele et al., 2015
mandibular arch skeleton atrophied, abnormal	WT + MO1-znf385c	standard conditions	Fig. 2 from Hochgreb-Hägele et al., 2015
forebrain apoptotic, abnormal	WT + MO1-znf385c	standard conditions	Fig. 3 from Hochgreb-Hägele et al., 2015
Meckel's cartilage decreased width, abnormal	WT + MO1-znf385c	standard conditions	Fig. 2 from Hochgreb-Hägele et al., 2015
ceratohyal cartilage decreased size, abnormal	WT + MO1-znf385c	standard conditions	Fig. 2 from Hochgreb-Hägele et al., 2015
pharyngeal arch apoptotic, abnormal	WT + MO1-znf385c	standard conditions	Fig. 3 from Hochgreb-Hägele et al., 2015
heart edematous, abnormal	WT + MO1-znf385c	standard conditions	Fig. 2 from Hochgreb-Hägele et al., 2015
head decreased size, abnormal	WT + MO1-znf385c	standard conditions	Fig. 2 from Hochgreb-Hägele et al., 2015
head chondrocyte maturity, abnormal	ba2Tg + MO1-znf385c	standard conditions	Fig. 2 from Hochgreb-Hägele et al., 2015
mandibular arch skeleton atrophied, abnormal	ba2Tg + MO1-znf385c	standard conditions	Fig. 2 from Hochgreb-Hägele et al., 2015
Meckel's cartilage decreased width, abnormal	ba2Tg + MO1-znf385c	standard conditions	Fig. 2 from Hochgreb-Hägele et al., 2015
head chondrocyte decreased amount, abnormal	ba2Tg + MO1-znf385c	standard conditions	Fig. 2 from Hochgreb-Hägele et al., 2015
ceratohyal cartilage decreased size, abnormal	ba2Tg + MO1-znf385c	standard conditions	Fig. 2 from Hochgreb-Hägele et al., 2015

Citations