Morpholino

MO3-dcdc2b

ID

ZDB-MRPHLNO-150514-2

Name

MO3-dcdc2b

Previous Names

None

Target

Sequence

5' - GTGTTTTAGACTGTGAAAAAGAGTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

In4 - Ex5 splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-dcdc2b

No data available

Phenotype

Phenotype resulting from MO3-dcdc2b

Phenotype	Fish	Figures
hair cell decreased functionality, abnormal	AB + MO3-dcdc2b	Fig. 4 from Grati et al., 2015
neuromast hair cell decreased amount, abnormal	s356tTg + MO3-dcdc2b	Fig. 4 from Grati et al., 2015
neuromast hair cell degenerate, abnormal	s356tTg + MO3-dcdc2b	Fig. 4 from Grati et al., 2015
neuromast hair cell kinocilium morphology, abnormal	s356tTg + MO3-dcdc2b	Fig. 4 from Grati et al., 2015
neuromast hair cell stereocilium bundle morphology, abnormal	s356tTg + MO3-dcdc2b	Fig. 4 from Grati et al., 2015
saccule hair cell decreased amount, abnormal	s356tTg + MO3-dcdc2b	Fig. 4 from Grati et al., 2015
semicircular canal hair cell decreased amount, abnormal	s356tTg + MO3-dcdc2b	Fig. 4 from Grati et al., 2015
sensory perception of sound disrupted, abnormal	AB + MO3-dcdc2b	Fig. 4 from Grati et al., 2015
swimming disrupted, abnormal	AB + MO3-dcdc2b	text only from Grati et al., 2015

Phenotype of all Fish created by or utilizing MO3-dcdc2b

Phenotype	Fish	Conditions	Figures
hair cell decreased functionality, abnormal	AB + MO3-dcdc2b	standard conditions	Fig. 4 from Grati et al., 2015
swimming disrupted, abnormal	AB + MO3-dcdc2b	standard conditions	text only from Grati et al., 2015
sensory perception of sound disrupted, abnormal	AB + MO3-dcdc2b	standard conditions	Fig. 4 from Grati et al., 2015
neuromast hair cell stereocilium bundle morphology, abnormal	s356tTg + MO3-dcdc2b	standard conditions	Fig. 4 from Grati et al., 2015
neuromast hair cell decreased amount, abnormal	s356tTg + MO3-dcdc2b	standard conditions	Fig. 4 from Grati et al., 2015
neuromast hair cell kinocilium morphology, abnormal	s356tTg + MO3-dcdc2b	standard conditions	Fig. 4 from Grati et al., 2015
saccule hair cell decreased amount, abnormal	s356tTg + MO3-dcdc2b	standard conditions	Fig. 4 from Grati et al., 2015
neuromast hair cell degenerate, abnormal	s356tTg + MO3-dcdc2b	standard conditions	Fig. 4 from Grati et al., 2015
semicircular canal hair cell decreased amount, abnormal	s356tTg + MO3-dcdc2b	standard conditions	Fig. 4 from Grati et al., 2015

Citations