Morpholino

MO1-otofb

ID

ZDB-MRPHLNO-150508-4

Name

MO1-otofb

Previous Names

e38i38 (1)

Target

otofb (1)

Sequence

5' - ACATTGTAAAACAGCACACCCAAGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-otofb

No data available

Phenotype

Phenotype resulting from MO1-otofb

Phenotype	Fish	Figures
locomotory behavior decreased process quality, abnormal	SPF 5-D + MO1-otofb	Fig. S6 from Chatterjee et al., 2015

Phenotype of all Fish created by or utilizing MO1-otofb

Phenotype	Fish	Conditions	Figures
locomotory behavior decreased process quality, abnormal	SPF 5-D + MO1-otofb	standard conditions	Fig. S6 from Chatterjee et al., 2015
swim bladder inflation decreased process quality, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Fig. 6 from Chatterjee et al., 2015
neuromast hair cell ribbon synapse spatial pattern, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Figure 2 from Manchanda et al., 2019
locomotory behavior decreased process quality, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Fig. S6 from Chatterjee et al., 2015
auditory behavior decreased process quality, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Fig. 8 from Chatterjee et al., 2015
whole organism rtn4rl2b expression decreased amount, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Figure 4 from Manchanda et al., 2019
neuromast hair cell synaptic vesicle recycling decreased process quality, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Figure 1 from Manchanda et al., 2019
neuromast hair cell ribbon synapse amount, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Figure 2 from Manchanda et al., 2019
whole organism otofb expression decreased amount, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Figure 4 from Manchanda et al., 2019
neuromast ab1-otof labeling absent, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Figure 1 from Manchanda et al., 2019
neuromast hair cell ribbon synapse size, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Figure 2 from Manchanda et al., 2019
startle response decreased process quality, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Fig. 8 from Chatterjee et al., 2015
whole organism rtn4rl2a expression decreased amount, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Figure 4 from Manchanda et al., 2019
startle response process quality, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Fig. 8 from Chatterjee et al., 2015
equilibrioception decreased process quality, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Fig. 6 from Chatterjee et al., 2015
spinal cord curved, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Fig. 6 from Chatterjee et al., 2015
whole organism pvalb9 expression increased amount, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Figure 4 from Manchanda et al., 2019
whole organism s100s expression decreased amount, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Figure 4 from Manchanda et al., 2019
whole organism ctbp2l expression decreased amount, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Figure 2 from Manchanda et al., 2019
whole organism otofa expression decreased amount, abnormal	SPF 5-D + MO1-otofb + MO2-otofa	standard conditions	Figure 4 from Manchanda et al., 2019
neuromast ab1-otof labeling absent, abnormal	vo10Tg + MO1-otofb + MO2-otofa	standard conditions	Figure 3 from Manchanda et al., 2019
neuromast hair cell calcium(2+) increased amount, abnormal	vo10Tg + MO1-otofb + MO2-otofa	standard conditions	Figure 3 from Manchanda et al., 2019
neuromast hair cell intracellular calcium ion homeostasis disrupted, abnormal	vo10Tg + MO1-otofb + MO2-otofa	standard conditions	Figure 3 from Manchanda et al., 2019

Citations