Morpholino

MO2-notch2

ID

ZDB-MRPHLNO-150129-1

Name

MO2-notch2

Previous Names

None

Target

notch2 (1)

Sequence

5' - TTCGAATGTGAAAGTCTTACCTGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-notch2

Expressed Gene	Anatomy	Figures
dlc	dorsal aorta	Fig. S4 from Kim et al., 2014
efnb2a	dorsal aorta	Fig. S4 from Kim et al., 2014
foxc1b	sclerotome	Fig. S4 from Kim et al., 2014
kdrl	endothelial cell	Fig. S4 from Kim et al., 2014
myod1	somite	Fig. S4 from Kim et al., 2014
runx1	hematopoietic multipotent progenitor cell	Fig. S4 from Kim et al., 2014
twist1b	sclerotome	Fig. S4 from Kim et al., 2014

Phenotype

Phenotype resulting from MO2-notch2

Phenotype	Fish	Figures
brain vasculature mural cell decreased amount, abnormal	ncv1Tg; ncv22Tg + MO2-notch2	Fig. 3 from Ando et al., 2019
dorsal aorta mural cell decreased amount, abnormal	ncv1Tg; ncv22Tg + MO2-notch2	Fig. 3 from Ando et al., 2019
intersegmental vessel mural cell decreased amount, abnormal	ncv1Tg; ncv22Tg + MO2-notch2	Fig. 3 from Ando et al., 2019
vasculature development process quality, abnormal	AB + MO2-notch2	Fig. S4 from Kim et al., 2014

Phenotype of all Fish created by or utilizing MO2-notch2

Phenotype	Fish	Conditions	Figures
vasculature development process quality, abnormal	AB + MO2-notch2	standard conditions	Fig. S4 from Kim et al., 2014
dorsal aorta mural cell decreased amount, abnormal	ncv1Tg; ncv22Tg + MO2-notch2	standard conditions	Fig. 3 from Ando et al., 2019
brain vasculature mural cell decreased amount, abnormal	ncv1Tg; ncv22Tg + MO2-notch2	standard conditions	Fig. 3 from Ando et al., 2019
intersegmental vessel mural cell decreased amount, abnormal	ncv1Tg; ncv22Tg + MO2-notch2	standard conditions	Fig. 3 from Ando et al., 2019
dorsal aorta mural cell absent, abnormal	ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2	standard conditions	Fig. 3 from Ando et al., 2019
intersegmental vessel mural cell absent, abnormal	ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2	standard conditions	Fig. 3 from Ando et al., 2019
brain vasculature mural cell absent, abnormal	ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2	standard conditions	Fig. 3 from Ando et al., 2019
intersegmental vessel mural cell decreased amount, exacerbated	ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2	chemical treatment by environment: DAPT	Fig. 3 from Ando et al., 2019
intersegmental vessel mural cell decreased amount, abnormal	ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2	standard conditions	Fig. 3 from Ando et al., 2019
hyaloid vessel mural cell decreased amount, abnormal	ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2	standard conditions	Fig. 3 from Ando et al., 2019
brain vasculature pericyte absent, abnormal	ncv1Tg; ncv34Tg; nkuasgfp1aTg + MO1-notch3 + MO2-notch2	standard conditions	Fig. 3 from Ando et al., 2019
brain vasculature pericyte decreased amount, abnormal	ncv1Tg; ncv34Tg; nkuasgfp1aTg + MO1-notch3 + MO2-notch2	standard conditions	Fig. 3 from Ando et al., 2019

Citations