Morpholino

MO2-fer

ID
ZDB-MRPHLNO-141208-2
Name
MO2-fer
Previous Names
None
Target
Sequence
5' - GGGATTACACTTACTGACGAAGAGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-fer
No data available
Phenotype
Phenotype resulting from MO2-fer
Phenotype Fish Figures
ceratohyal cartilage malformed, abnormal WT + MO2-fer Fig. 3 with image,  Fig. 5 with image from Paardekooper Overman et al., 2014
convergent extension involved in gastrulation process quality, abnormal WT + MO2-fer Fig. 4 with image from Paardekooper Overman et al., 2014
cranium malformed, abnormal WT + MO2-fer Fig. 3 with image,  Fig. 5 with image from Paardekooper Overman et al., 2014
eye far from eye, abnormal ba2Tg + MO2-fer Fig. 3 with image from Paardekooper Overman et al., 2014
heart edematous, abnormal WT + MO2-fer Fig. 3 with image from Paardekooper Overman et al., 2014
Meckel's cartilage malformed, abnormal WT + MO2-fer Fig. 3 with image from Paardekooper Overman et al., 2014
whole organism decreased length, abnormal WT + MO2-fer Fig. 3 with image from Paardekooper Overman et al., 2014
Phenotype of all Fish created by or utilizing MO2-fer
Phenotype Fish Conditions Figures
Meckel's cartilage malformed, abnormal WT + MO1-fer + MO2-fer standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
cranium malformed, abnormal WT + MO1-fer + MO2-fer standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
ceratohyal cartilage malformed, abnormal WT + MO1-fer + MO2-fer standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
convergent extension involved in gastrulation process quality, abnormal WT + MO2-fer standard conditions Fig. 4 with image from Paardekooper Overman et al., 2014
whole organism decreased length, abnormal WT + MO2-fer standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
ceratohyal cartilage malformed, abnormal WT + MO2-fer standard conditions Fig. 3 with image,  Fig. 5 with image from Paardekooper Overman et al., 2014
cranium malformed, abnormal WT + MO2-fer standard conditions Fig. 3 with image,  Fig. 5 with image from Paardekooper Overman et al., 2014
heart edematous, abnormal WT + MO2-fer standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
Meckel's cartilage malformed, abnormal WT + MO2-fer standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
cranium malformed, abnormal WT + MO2-fer + MO4-tp53 standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
whole organism decreased length, abnormal WT + MO2-fer + MO4-tp53 standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
heart edematous, abnormal WT + MO2-fer + MO4-tp53 standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
ceratohyal cartilage malformed, abnormal ba2Tg + MO2-fer standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
Meckel's cartilage malformed, abnormal ba2Tg + MO2-fer standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
eye far from eye, abnormal ba2Tg + MO2-fer standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
cranium malformed, abnormal ba2Tg + MO2-fer standard conditions Fig. 3 with image from Paardekooper Overman et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.