Morpholino

MO2-clstn1

ID
ZDB-MRPHLNO-141003-2
Name
MO2-clstn1
Previous Names
None
Target
Sequence
5' - GAGTTTTGGCAGTCACTTACCATCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-clstn1
No data available
Phenotype
Phenotype resulting from MO2-clstn1
Phenotype Fish Figures
Rohon-Beard neuron anterograde axonal transport decreased occurrence, abnormal uw4Tg + MO2-clstn1 Fig. 6Fig. 7 from Ponomareva et al., 2014
Rohon-Beard neuron axon decreased branchiness, abnormal uw4Tg + MO2-clstn1 Fig. 2Fig. 4 from Ponomareva et al., 2014
Rohon-Beard neuron axon extension increased rate, abnormal uw4Tg + MO2-clstn1 Fig. 4 from Ponomareva et al., 2014
Rohon-Beard neuron collateral sprouting decreased occurrence, abnormal uw4Tg + MO2-clstn1 Fig. 2Fig. 4 from Ponomareva et al., 2014
Rohon-Beard neuron early endosome mislocalised, abnormal uw4Tg + MO2-clstn1 Fig. 7 from Ponomareva et al., 2014
Rohon-Beard neuron endocytic recycling decreased occurrence, abnormal uw4Tg + MO2-clstn1 Fig. 6Fig. 7 from Ponomareva et al., 2014
Rohon-Beard neuron filopodium collapsed, abnormal AB + MO2-clstn1 Fig. 5 with image from Lee et al., 2017
Rohon-Beard neuron filopodium decreased stability, abnormal AB + MO2-clstn1 Fig. 5 with image from Lee et al., 2017
Rohon-Beard neuron growth cone decreased branchiness, abnormal uw4Tg + MO2-clstn1 Fig. 4 from Ponomareva et al., 2014
Rohon-Beard neuron growth cone decreased volume, abnormal uw4Tg + MO2-clstn1 Fig. 4 from Ponomareva et al., 2014
Rohon-Beard neuron retrograde axonal transport increased occurrence, abnormal AB + MO2-clstn1 Fig. 3 with image from Lee et al., 2017
trigeminal ganglion axon decreased branchiness, abnormal AB + MO2-clstn1 Fig. 2 from Ponomareva et al., 2014
trigeminal ganglion collateral sprouting decreased occurrence, abnormal AB + MO2-clstn1 Fig. 2 from Ponomareva et al., 2014
Phenotype of all Fish created by or utilizing MO2-clstn1
Phenotype Fish Conditions Figures
trigeminal ganglion collateral sprouting decreased occurrence, abnormal AB + MO2-clstn1 standard conditions Fig. 2 from Ponomareva et al., 2014
Rohon-Beard neuron filopodium decreased stability, abnormal AB + MO2-clstn1 control Fig. 5 with image from Lee et al., 2017
Rohon-Beard neuron filopodium collapsed, abnormal AB + MO2-clstn1 control Fig. 5 with image from Lee et al., 2017
Rohon-Beard neuron axon decreased branchiness, abnormal AB + MO2-clstn1 standard conditions Fig. 2 from Ponomareva et al., 2014
Rohon-Beard neuron collateral sprouting decreased occurrence, abnormal AB + MO2-clstn1 standard conditions Fig. 2 from Ponomareva et al., 2014
trigeminal ganglion axon decreased branchiness, abnormal AB + MO2-clstn1 standard conditions Fig. 2 from Ponomareva et al., 2014
Rohon-Beard neuron retrograde axonal transport increased occurrence, abnormal AB + MO2-clstn1 control Fig. 3 with image from Lee et al., 2017
Rohon-Beard neuron growth cone decreased volume, abnormal uw4Tg + MO2-clstn1 standard conditions Fig. 4 from Ponomareva et al., 2014
Rohon-Beard neuron anterograde axonal transport decreased occurrence, abnormal uw4Tg + MO2-clstn1 standard conditions Fig. 6Fig. 7 from Ponomareva et al., 2014
Rohon-Beard neuron axon decreased branchiness, abnormal uw4Tg + MO2-clstn1 standard conditions Fig. 4 from Ponomareva et al., 2014
Rohon-Beard neuron early endosome mislocalised, abnormal uw4Tg + MO2-clstn1 standard conditions Fig. 7 from Ponomareva et al., 2014
Rohon-Beard neuron endocytic recycling decreased occurrence, abnormal uw4Tg + MO2-clstn1 standard conditions Fig. 6Fig. 7 from Ponomareva et al., 2014
Rohon-Beard neuron collateral sprouting decreased occurrence, abnormal uw4Tg + MO2-clstn1 standard conditions Fig. 4 from Ponomareva et al., 2014
Rohon-Beard neuron growth cone decreased branchiness, abnormal uw4Tg + MO2-clstn1 standard conditions Fig. 4 from Ponomareva et al., 2014
Rohon-Beard neuron axon extension increased rate, abnormal uw4Tg + MO2-clstn1 standard conditions Fig. 4 from Ponomareva et al., 2014
Citations