Morpholino

MO1-dstyk

ID
ZDB-MRPHLNO-140731-2
Name
MO1-dstyk
Previous Names
None
Target
Sequence
5' - ACACTGGCCGTGTACCTTCAGTCCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocker.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dstyk
No data available
Phenotype
Phenotype resulting from MO1-dstyk
Phenotype Fish Figures
cloaca malformed, abnormal AB/TU + MO1-dstyk Fig. S6 from Sanna-Cherchi et al., 2013
embryo development delayed, abnormal AB/TU + MO1-dstyk Fig. S6 from Sanna-Cherchi et al., 2013
fin development disrupted, abnormal AB/TU + MO1-dstyk Fig. S6 from Sanna-Cherchi et al., 2013
notochord deformed, abnormal AB/TU + MO1-dstyk Fig. S6 from Sanna-Cherchi et al., 2013
pharyngeal arch 1 malformed, abnormal AB/TU + MO1-dstyk Fig. S6 from Sanna-Cherchi et al., 2013
pronephric duct opening closed, abnormal AB/TU + MO1-dstyk Fig. S6 from Sanna-Cherchi et al., 2013
somite condensed, abnormal AB/TU + MO1-dstyk Fig. S6 from Sanna-Cherchi et al., 2013
whole organism decreased life span, abnormal AB/TU + MO1-dstyk Fig. S6 from Sanna-Cherchi et al., 2013
whole organism edematous, abnormal AB/TU + MO1-dstyk Fig. S6 from Sanna-Cherchi et al., 2013
whole organism lacks all parts of type ventral fin fold, abnormal AB/TU + MO1-dstyk Fig. S6 from Sanna-Cherchi et al., 2013
whole organism anterior-posterior axis increased curvature, abnormal AB/TU + MO1-dstyk Fig. S6 from Sanna-Cherchi et al., 2013
whole organism anterior-posterior axis undulate, abnormal AB/TU + MO1-dstyk Fig. S6 from Sanna-Cherchi et al., 2013
Phenotype of all Fish created by or utilizing MO1-dstyk
Phenotype Fish Conditions Figures
cloaca malformed, abnormal AB/TU + MO1-dstyk standard conditions Fig. S6 from Sanna-Cherchi et al., 2013
whole organism decreased life span, abnormal AB/TU + MO1-dstyk standard conditions Fig. S6 from Sanna-Cherchi et al., 2013
pronephric duct opening closed, abnormal AB/TU + MO1-dstyk standard conditions Fig. S6 from Sanna-Cherchi et al., 2013
whole organism anterior-posterior axis increased curvature, abnormal AB/TU + MO1-dstyk standard conditions Fig. S6 from Sanna-Cherchi et al., 2013
somite condensed, abnormal AB/TU + MO1-dstyk standard conditions Fig. S6 from Sanna-Cherchi et al., 2013
whole organism anterior-posterior axis undulate, abnormal AB/TU + MO1-dstyk standard conditions Fig. S6 from Sanna-Cherchi et al., 2013
whole organism edematous, abnormal AB/TU + MO1-dstyk standard conditions Fig. S6 from Sanna-Cherchi et al., 2013
fin development disrupted, abnormal AB/TU + MO1-dstyk standard conditions Fig. S6 from Sanna-Cherchi et al., 2013
notochord deformed, abnormal AB/TU + MO1-dstyk standard conditions Fig. S6 from Sanna-Cherchi et al., 2013
whole organism lacks all parts of type ventral fin fold, abnormal AB/TU + MO1-dstyk standard conditions Fig. S6 from Sanna-Cherchi et al., 2013
pharyngeal arch 1 malformed, abnormal AB/TU + MO1-dstyk standard conditions Fig. S6 from Sanna-Cherchi et al., 2013
embryo development delayed, abnormal AB/TU + MO1-dstyk standard conditions Fig. S6 from Sanna-Cherchi et al., 2013
whole organism edematous, abnormal tp53zdf1/zdf1 + MO1-dstyk standard conditions text only from Sanna-Cherchi et al., 2013
fin development disrupted, abnormal tp53zdf1/zdf1 + MO1-dstyk standard conditions text only from Sanna-Cherchi et al., 2013
whole organism decreased life span, abnormal tp53zdf1/zdf1 + MO1-dstyk standard conditions text only from Sanna-Cherchi et al., 2013
notochord deformed, abnormal tp53zdf1/zdf1 + MO1-dstyk standard conditions text only from Sanna-Cherchi et al., 2013
whole organism anterior-posterior axis undulate, abnormal tp53zdf1/zdf1 + MO1-dstyk standard conditions text only from Sanna-Cherchi et al., 2013
pharyngeal arch 1 malformed, abnormal tp53zdf1/zdf1 + MO1-dstyk standard conditions text only from Sanna-Cherchi et al., 2013
embryo development delayed, abnormal tp53zdf1/zdf1 + MO1-dstyk standard conditions text only from Sanna-Cherchi et al., 2013
somite condensed, abnormal tp53zdf1/zdf1 + MO1-dstyk standard conditions text only from Sanna-Cherchi et al., 2013
cloaca malformed, abnormal tp53zdf1/zdf1 + MO1-dstyk standard conditions text only from Sanna-Cherchi et al., 2013
pronephric duct opening closed, abnormal tp53zdf1/zdf1 + MO1-dstyk standard conditions text only from Sanna-Cherchi et al., 2013
whole organism anterior-posterior axis increased curvature, abnormal tp53zdf1/zdf1 + MO1-dstyk standard conditions text only from Sanna-Cherchi et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.