Morpholino

MO4-bbs4

ID
ZDB-MRPHLNO-140729-2
Name
MO4-bbs4
Previous Names
None
Target
Sequence
5' - CCGTTCTCATAGCGTCGTCCGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-bbs4
Expressed Gene Anatomy Figures
her4.1 Fig. 5,  Fig. S5,  Fig. S6 from Liu et al., 2014
Phenotype
Phenotype resulting from MO4-bbs4
Phenotype Fish Figures
convergent extension disrupted, abnormal WT + MO4-bbs4 Fig. 5,  Fig. S5,  Fig. S6 from Liu et al., 2014
convergent extension involved in axis elongation decreased occurrence, abnormal AB/EKW + MO4-bbs4 Fig. 2,  Fig. S4,  Fig. S11 from Tsai et al., 2019
proximal convoluted tubule atrophied, abnormal AB/EKW + MO4-bbs4 Fig. 2 from Tsai et al., 2019
proximal convoluted tubule morphology, abnormal AB/EKW + MO4-bbs4 Fig. 2 from Tsai et al., 2019
proximal convoluted tubule development decreased occurrence, abnormal AB/EKW + MO4-bbs4 Fig. 2 from Tsai et al., 2019
somite increased width, abnormal WT + MO4-bbs4 Fig. 5,  Fig. S6 from Liu et al., 2014
somite border amorphous, abnormal WT + MO4-bbs4 Fig. 5,  Fig. S5,  Fig. S6 from Liu et al., 2014
whole organism anterior-posterior axis decreased length, abnormal WT + MO4-bbs4 Fig. 5,  Fig. S6 from Liu et al., 2014
Phenotype of all Fish created by or utilizing MO4-bbs4
Phenotype Fish Conditions Figures
proximal convoluted tubule development decreased occurrence, abnormal AB/EKW + MO4-bbs4 standard conditions Fig. 2 from Tsai et al., 2019
proximal convoluted tubule atrophied, abnormal AB/EKW + MO4-bbs4 standard conditions Fig. 2 from Tsai et al., 2019
convergent extension involved in axis elongation decreased occurrence, abnormal AB/EKW + MO4-bbs4 standard conditions Fig. 2,  Fig. S4,  Fig. S11 from Tsai et al., 2019
proximal convoluted tubule morphology, abnormal AB/EKW + MO4-bbs4 standard conditions Fig. 2 from Tsai et al., 2019
convergent extension disrupted, abnormal WT + MO4-bbs4 standard conditions Fig. 5,  Fig. S5,  Fig. S6 from Liu et al., 2014
whole organism anterior-posterior axis decreased length, abnormal WT + MO4-bbs4 standard conditions Fig. 5,  Fig. S6 from Liu et al., 2014
somite increased width, abnormal WT + MO4-bbs4 standard conditions Fig. 5,  Fig. S6 from Liu et al., 2014
somite border amorphous, abnormal WT + MO4-bbs4 standard conditions Fig. 5,  Fig. S5,  Fig. S6 from Liu et al., 2014
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO1-dtx1 + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO1-engase + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
convergent extension involved in axis elongation decreased occurrence, exacerbated AB/EKW + MO1-enpp7.1 + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO1-entpd6 + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
convergent extension involved in axis elongation decreased occurrence, abnormal AB/EKW + MO1-pitpnm2 + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO1-ptmaa + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO1-rtraf + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO1-tdrd12 + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO1-tex36 + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
proximal convoluted tubule morphology, ameliorated AB/EKW + MO1-usp38 + MO4-bbs4 standard conditions Fig. 2 from Tsai et al., 2019
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO1-usp38 + MO4-bbs4 standard conditions Fig. 2,  Fig. S11 from Tsai et al., 2019
proximal convoluted tubule atrophied, ameliorated AB/EKW + MO1-usp38 + MO4-bbs4 standard conditions Fig. 2 from Tsai et al., 2019
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO2-zic1 + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.