Morpholino

MO2-zgc:100846

ID

ZDB-MRPHLNO-140617-2

Name

MO2-zgc:100846

Previous Names

C9AMOb (1)
zC9orf72 AMO (1)

Target

zgc:100846 (1)

Sequence

5' - ATTGTGGAGGACAGGCTGAAGACAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-zgc:100846

No data available

Phenotype

Phenotype resulting from MO2-zgc:100846

Phenotype	Fish	Figures
motor neuron axon branchiness, abnormal	AB + MO2-zgc:100846	Fig. 3 from Ciura et al., 2013
motor neuron axon decreased length, abnormal	ml2Tg + MO2-zgc:100846	Fig. 1 from Chaytow et al., 2022 Fig. 3 from Ciura et al., 2013
motor neuron axon increased branchiness, abnormal	ml2Tg + MO2-zgc:100846	Fig. 1 from Chaytow et al., 2022
swimming process quality, abnormal	AB + MO2-zgc:100846	Fig. 5, Fig. S7 from Ciura et al., 2013
swimming behavior decreased process quality, abnormal	AB + MO2-zgc:100846	Fig. 4 from Ciura et al., 2013
thigmotaxis disrupted, abnormal	AB + MO2-zgc:100846	Fig. 2 from Chaytow et al., 2022 Fig. 3, Fig. 4 from Ciura et al., 2013
whole organism dead, abnormal	AB + MO2-zgc:100846	Fig. 3 from Ciura et al., 2013
whole organism decreased mobility, abnormal	AB + MO2-zgc:100846	Fig. 5, Fig. S7 from Ciura et al., 2013

Phenotype of all Fish created by or utilizing MO2-zgc:100846

Phenotype	Fish	Conditions	Figures
whole organism dead, abnormal	AB + MO2-zgc:100846	standard conditions	Fig. 3 from Ciura et al., 2013
whole organism decreased mobility, abnormal	AB + MO2-zgc:100846	standard conditions	Fig. 5, Fig. S7 from Ciura et al., 2013
motor neuron axon decreased length, abnormal	AB + MO2-zgc:100846	standard conditions	Fig. 3 from Ciura et al., 2013
swimming process quality, abnormal	AB + MO2-zgc:100846	standard conditions	Fig. 5, Fig. S7 from Ciura et al., 2013
motor neuron axon branchiness, abnormal	AB + MO2-zgc:100846	standard conditions	Fig. 3 from Ciura et al., 2013
thigmotaxis disrupted, abnormal	AB + MO2-zgc:100846	standard conditions	Fig. 3, Fig. 4 from Ciura et al., 2013
swimming behavior decreased process quality, abnormal	AB + MO2-zgc:100846	standard conditions	Fig. 4 from Ciura et al., 2013
thigmotaxis process quality, ameliorated	ml2Tg + MO2-zgc:100846	chemical treatment by environment: terazosin	Fig. 2 from Chaytow et al., 2022
motor neuron axon decreased length, ameliorated	ml2Tg + MO2-zgc:100846	chemical treatment by environment: terazosin	Fig. 1 from Chaytow et al., 2022
motor neuron axon increased branchiness, abnormal	ml2Tg + MO2-zgc:100846	standard conditions	Fig. 1 from Chaytow et al., 2022
motor neuron axon decreased length, abnormal	ml2Tg + MO2-zgc:100846	standard conditions	Fig. 1 from Chaytow et al., 2022
thigmotaxis disrupted, abnormal	ml2Tg + MO2-zgc:100846	standard conditions	Fig. 2 from Chaytow et al., 2022
motor neuron axon decreased branchiness, ameliorated	ml2Tg + MO2-zgc:100846	chemical treatment by environment: terazosin	Fig. 1 from Chaytow et al., 2022

Citations